ID: 967480406

View in Genome Browser
Species Human (GRCh38)
Location 3:189966248-189966270
Sequence CCTGACCAGCACCAGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967480406_967480412 29 Left 967480406 3:189966248-189966270 CCCACTCCCTGGTGCTGGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 251
Right 967480412 3:189966300-189966322 TCTATGTGATTACCAAGTCTTGG 0: 1
1: 0
2: 2
3: 21
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967480406 Original CRISPR CCTGACCAGCACCAGGGAGT GGG (reversed) Intronic
902477473 1:16695922-16695944 CCTGCCCAGCACCTGGGATCTGG - Intergenic
902814546 1:18908666-18908688 CCTGAGAAGCACAAGAGAGTGGG + Exonic
903812592 1:26043153-26043175 CCTGACATGTATCAGGGAGTGGG + Intronic
904454834 1:30641375-30641397 TCTGCCCAGAACCTGGGAGTGGG + Intergenic
905178352 1:36151917-36151939 CATCACCAGCCACAGGGAGTGGG + Intronic
907423954 1:54366978-54367000 CCTTTCCAGCACGAGGGATTCGG - Intronic
907766697 1:57420114-57420136 CCTTATCATCAACAGGGAGTGGG - Intronic
908458221 1:64324780-64324802 CTAGTCCAGCACCAGGAAGTGGG + Intergenic
909169934 1:72282541-72282563 ACTCGCCAGCACCAGGGGGTGGG - Exonic
912239383 1:107888991-107889013 CCTACCCAGCACCAGTGGGTGGG + Intronic
913330273 1:117661495-117661517 CCTGACCAGTTCTAGGGATTAGG + Intergenic
915910586 1:159912644-159912666 CCTGATCAGCCCAGGGGAGTAGG - Intergenic
917464368 1:175262191-175262213 CCTGAGAAGCACCAGGGGTTGGG - Intergenic
918047729 1:180951664-180951686 CATGGGCAGGACCAGGGAGTGGG + Intergenic
919283222 1:195518724-195518746 CCTTACCAGCTCCAAGGAGTGGG + Intergenic
920336941 1:205251213-205251235 CCTGAGCTGCAGTAGGGAGTTGG + Intronic
920344561 1:205297999-205298021 CAGGACCAGGACCAGTGAGTGGG - Intergenic
920427528 1:205889993-205890015 CATGACCAGCACCAGAGTTTTGG + Intergenic
921838280 1:219800949-219800971 CATGACCACCACCAAGGAGCTGG - Intronic
922250766 1:223846444-223846466 CCTGGCCGCCTCCAGGGAGTCGG - Intergenic
922808179 1:228401358-228401380 TCTGGCCAGCACCAGGTGGTGGG - Intronic
923074746 1:230600345-230600367 TCTGTCCTGCACCAGGGAGCTGG + Intergenic
924180366 1:241434598-241434620 CGTGACCAGCACCGGGGTTTTGG - Intergenic
924437372 1:244054308-244054330 CCTGCCCAGCAAAAGGGACTTGG + Exonic
1063527955 10:6802172-6802194 CATGACCAGCACCAGAGTTTTGG + Intergenic
1063942718 10:11147108-11147130 CCTGGCAGGCACAAGGGAGTGGG - Intronic
1066049014 10:31618397-31618419 TCAGGCCAGCACCAGGGACTGGG + Intergenic
1067096924 10:43307552-43307574 CCTGACCTGCTCCTGGGAGGGGG + Intergenic
1068595395 10:58897692-58897714 CCTGTACAACACCAGGGACTTGG + Intergenic
1071136239 10:82457735-82457757 CCTGACCAGCATCAGCCTGTAGG + Intronic
1072674259 10:97453862-97453884 CCTGAGCAGCAGGAGGCAGTGGG - Intronic
1073511080 10:104042722-104042744 CCTGACAAGCTCCAGTGAGAAGG - Intronic
1074078639 10:110151133-110151155 TCTGACCATCCCCAGGGAGCGGG - Intergenic
1075399177 10:122149373-122149395 CCTGCCCAGCACCGGGGATCCGG - Intronic
1075519422 10:123135199-123135221 CCTGTCCAGCCCCAGGGGGCGGG + Intergenic
1076610511 10:131723165-131723187 CCTGCTCCGCACCAGGGAGAGGG - Intergenic
1076715038 10:132359437-132359459 CCTGCCCAGCTGCAGGGAGCTGG - Intronic
1076944575 10:133637491-133637513 CCTGAGGAGCACCAGGGGGCCGG - Intergenic
1079029897 11:16978906-16978928 CCTGAACTGCAGCAGGGTGTGGG - Intronic
1083166711 11:60892978-60893000 CCTGAACTGCAGAAGGGAGTAGG - Intronic
1083174948 11:60943740-60943762 CTTCACCAGCACCTGGAAGTTGG + Exonic
1083440594 11:62673488-62673510 CCTGACCAGATCCAGAGATTGGG - Exonic
1083997651 11:66280008-66280030 GCTGACCAGCTCCTGGGAGAAGG + Intronic
1084173075 11:67409863-67409885 CCTGGCAAGGACCAGGCAGTGGG + Exonic
1085934070 11:81122823-81122845 CGTGACCAGCACCAGAGTTTTGG - Intergenic
1086168304 11:83806108-83806130 CCTGACCTGGACAAGGGAGAAGG - Intronic
1086396109 11:86416754-86416776 CCAGAGAAGGACCAGGGAGTTGG - Intronic
1086952957 11:92909535-92909557 CCTCACCAGCACCAGCCACTTGG - Intergenic
1089057824 11:115600987-115601009 ACTGCCCAGCACCAGTGTGTGGG + Intergenic
1089286848 11:117412851-117412873 CCTGAGGAGCCCCAGGGAGCAGG - Exonic
1090636175 11:128691948-128691970 ACTGGCCAGCACCAGGAAGGGGG + Intronic
1092174121 12:6391166-6391188 GCTGAGCAGCCCCAGGGGGTGGG - Exonic
1096088208 12:48880535-48880557 CCTGAATCCCACCAGGGAGTGGG + Intergenic
1096520886 12:52183964-52183986 CCTGACCATGACCGGGCAGTCGG - Intronic
1096767259 12:53901954-53901976 CCTGAGCAGTTCCAGGCAGTGGG + Intergenic
1097203474 12:57299883-57299905 ACAGACCTGCACCAGGGAGGAGG - Intronic
1097391661 12:59022276-59022298 ACTGAGTAGCACCAGGGAGTGGG - Intergenic
1099658564 12:85526470-85526492 CCAGAACAGCACCAAGGAGATGG - Intergenic
1100503049 12:95192994-95193016 CCTCACCAGCACTTGGTAGTTGG - Intronic
1101477251 12:105062634-105062656 CCTGCCCAAGACCAGCGAGTGGG + Intronic
1102028418 12:109726607-109726629 CCTGACCATCTCCAGGCAGTGGG - Intronic
1102478193 12:113202367-113202389 CCAACCCAGCACCAGGGAGGGGG + Intronic
1102705487 12:114876684-114876706 TCTTTTCAGCACCAGGGAGTTGG - Intergenic
1102952443 12:117039850-117039872 CCTGGCCAGAACCTTGGAGTGGG + Intronic
1103913039 12:124362595-124362617 CCTGTCCATCACCAGGCAGCTGG - Intronic
1103913071 12:124362692-124362714 CCTGTCCATCACCAGGCAGCTGG - Intronic
1103913115 12:124362839-124362861 CCTGTCCATCACCAGGCAGCTGG - Intronic
1103913142 12:124362940-124362962 CCTGTCCATCACCAGGCAGCTGG - Intronic
1103932810 12:124459503-124459525 CCTGCCCAACATCTGGGAGTCGG + Intronic
1104028831 12:125049555-125049577 CCTGACTGGCACCGGCGAGTCGG - Intergenic
1104124947 12:125837624-125837646 CCTGACCTTCACCATGAAGTGGG - Intergenic
1105837342 13:24223198-24223220 CCCCACCAGGACCATGGAGTGGG - Exonic
1106240711 13:27910757-27910779 CCTAAAAAGCAGCAGGGAGTGGG - Intergenic
1108431924 13:50361911-50361933 CCTGCCCAGCACTAGGCACTAGG + Intronic
1108595653 13:51946371-51946393 CGTGGCCAGCCCCAGGGAGCAGG + Exonic
1110046170 13:70834234-70834256 CCTCACTAGCTCCAGAGAGTTGG - Intergenic
1110359276 13:74607116-74607138 CCTGACAAGGACCAGGAAGAAGG - Intergenic
1110561805 13:76917753-76917775 CCTGGCCAGAACCAGGGGGAGGG + Intergenic
1113008676 13:105737929-105737951 CCTGCCCAGCACCAGCAGGTAGG + Intergenic
1114280336 14:21188159-21188181 CGTGAGGAGCACCAGGGAGCAGG - Intergenic
1117032242 14:51685009-51685031 CCAGACCAGATCCAGGGAGAGGG + Intronic
1119883611 14:78122064-78122086 CCTGGCCATCACCTGGGAATTGG + Intergenic
1202926661 14_KI270724v1_random:31760-31782 CCTGAGGAGCACCAGGAGGTCGG + Intergenic
1123432173 15:20227433-20227455 CCTAACCAGCACCAGCTGGTTGG - Intergenic
1124018855 15:25902078-25902100 CCTGCCAAGCACCAGTGAGCTGG + Intergenic
1129115638 15:73363974-73363996 AGTGACCAGCAGCAGGAAGTCGG + Intronic
1131249513 15:90821010-90821032 CACGGCCAGCACCAGGCAGTGGG + Intergenic
1134320828 16:13161119-13161141 CCTGGCTGGCTCCAGGGAGTTGG + Intronic
1135537206 16:23303277-23303299 ACTCACCTCCACCAGGGAGTAGG + Intronic
1135643680 16:24142915-24142937 CATGCCCAGCACTAGGGAGCAGG - Intronic
1135776745 16:25263168-25263190 CCTGACAAGCAGCTGGGAGCAGG - Intergenic
1136246375 16:28978535-28978557 CATGAACAGGACCAGGAAGTTGG - Intronic
1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1137363237 16:47839468-47839490 CGTGACCAGCACCAGAGTTTTGG - Intergenic
1138522245 16:57577704-57577726 CTTGGGCAGCCCCAGGGAGTGGG + Intronic
1139854118 16:69967236-69967258 CCTCAGCATCACCAGGGAGCTGG + Intergenic
1139883099 16:70190150-70190172 CCTCAGCATCACCAGGGAGCTGG + Intergenic
1140369409 16:74405370-74405392 CCTCAGCATCACCAGGGAGCTGG - Intergenic
1140564626 16:76027108-76027130 CCTGACAAGGACCCGGGTGTGGG + Intergenic
1141882656 16:86870098-86870120 ACTTCCCAGCACCAGGGAGGAGG + Intergenic
1142235876 16:88922323-88922345 CCTGTCCAGCAGCAGGGCCTAGG + Intronic
1203114065 16_KI270728v1_random:1472174-1472196 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1143389746 17:6553242-6553264 TCTAACCAGCAACAGGGAGGTGG - Intronic
1145276518 17:21434621-21434643 ACTGACCAGCACCTGGCAGGAGG + Intergenic
1145314359 17:21720514-21720536 ACTGACCAGCACCTGGCAGGGGG + Intergenic
1145712813 17:26992490-26992512 ACTGACCAGCACCTGGCAGGGGG + Intergenic
1145734138 17:27214569-27214591 CCTCTCCAGTCCCAGGGAGTTGG + Intergenic
1146685288 17:34837351-34837373 CCTGTCCTGCACCAGGGCTTGGG - Intergenic
1146965738 17:37028301-37028323 CCCGACCACCACCAAGGAGCTGG - Intronic
1147963814 17:44182425-44182447 ACAGAACAGCACCAGGGGGTGGG - Intergenic
1147980258 17:44269757-44269779 CCTGACCGGCACCAAGGCCTGGG - Intergenic
1149951916 17:60997263-60997285 CCAGTCCACCACCTGGGAGTTGG + Intronic
1151224731 17:72640042-72640064 CCAGCCCAGCACCTGGGAGAAGG - Intergenic
1151404766 17:73879105-73879127 CATGACCTGCACGAGGGACTCGG + Intergenic
1151458977 17:74243540-74243562 CCTGGCCAGCTCCAGAGTGTGGG + Intronic
1152069058 17:78126207-78126229 CCAGCCCAGCCCCAGGGACTGGG + Intronic
1152358232 17:79816781-79816803 CCTACCAAGCACCAGGCAGTTGG - Intergenic
1154219035 18:12436025-12436047 CGTGGGCAGCACCAGCGAGTCGG - Intergenic
1155510749 18:26574066-26574088 TCTGACCAGCACTAGTGAGAGGG - Intronic
1158443389 18:57497537-57497559 CCTAACCAAGAACAGGGAGTTGG - Intergenic
1158741667 18:60149563-60149585 TCTGACCAGCACCATGGTGGTGG + Intergenic
1160318103 18:77866816-77866838 CCAGACCAGAGCCAGGGCGTCGG - Intergenic
1160806400 19:994067-994089 CCTGTGCAGCACCATGGAGAAGG + Exonic
1161104600 19:2437058-2437080 TCTGGCCAGGCCCAGGGAGTGGG - Intronic
1161694364 19:5757832-5757854 GCTCACCATCACCTGGGAGTGGG - Exonic
1161861519 19:6801682-6801704 CCACCCCAGCACCAGGGAGCCGG - Intronic
1163250348 19:16123000-16123022 CCTCCCCTGCACCAGGCAGTGGG + Intronic
1163755976 19:19106334-19106356 TCTGACCAGGTCCAGGGGGTAGG - Exonic
1164508488 19:28878507-28878529 CCTGACCAGCAGCAGGAAAAAGG - Intergenic
1164627754 19:29740780-29740802 CCAGACCATAACCAGTGAGTGGG - Intergenic
1166140691 19:40803656-40803678 CCTGTCCCCAACCAGGGAGTTGG - Intronic
1166751356 19:45165284-45165306 ACTGACGAGCACCAGCAAGTTGG - Intronic
1167297753 19:48661845-48661867 GCTGCCCAGCAGCAGGTAGTCGG + Exonic
1167357803 19:49014811-49014833 CCTGACCACCCCCAGGGCGCTGG - Intronic
1167740293 19:51320491-51320513 CTGGACCAGGGCCAGGGAGTGGG - Intronic
1168347400 19:55657286-55657308 CCTGTCCAGCATCAGTGTGTGGG + Intronic
1202711493 1_KI270714v1_random:21748-21770 CCTGCCCAGCACCTGGGATCTGG - Intergenic
925066048 2:929475-929497 CCTGAAGGGCACCAGGAAGTCGG + Intergenic
925435163 2:3830640-3830662 CCTGCCCAGCCACATGGAGTGGG - Intronic
925773167 2:7304395-7304417 TCTGACCAGCAGCAGGAAGTTGG + Intergenic
926465570 2:13182169-13182191 CCTCACCAGAATTAGGGAGTTGG + Intergenic
926837248 2:17036748-17036770 ACTGACCAGCACCAGGAACCAGG - Intergenic
926998009 2:18759163-18759185 CCTGACCACCTCCAGGGAAGAGG - Intergenic
929095761 2:38261970-38261992 CCAGTCCAGCACCAGGTATTTGG - Intergenic
929258628 2:39840060-39840082 ACTGACTAGAACCAGGTAGTAGG - Intergenic
929262623 2:39882916-39882938 ACAGACCTGCACCAGGGAATGGG - Intergenic
929453888 2:42053283-42053305 CCTGACCACCATCACGGAGCTGG + Exonic
929882537 2:45849582-45849604 CCTGATCAGCACCTTGGAGCTGG - Intronic
930099322 2:47590769-47590791 CGTGACCAGCACCAGAGTTTTGG + Intergenic
931781464 2:65582470-65582492 CCTGCCCAGGTCCAGGGAGACGG + Intergenic
933806218 2:85999697-85999719 CGTGGCCAGCAGCAGGGAATAGG + Intergenic
934533349 2:95111177-95111199 CCTGACCAGAACAAAGGATTCGG + Intronic
934717862 2:96553667-96553689 CATGCCTGGCACCAGGGAGTGGG + Intergenic
935661891 2:105473903-105473925 CCAAACAGGCACCAGGGAGTGGG + Intergenic
935860663 2:107325591-107325613 GCAGACCACCACAAGGGAGTTGG + Intergenic
936042315 2:109159343-109159365 CCTGCCCAGCCCCAGGGCGAGGG + Intronic
936289988 2:111216018-111216040 CCAGACCAGCAGAATGGAGTGGG - Intergenic
936290090 2:111216701-111216723 CCAGACCAGCAGAATGGAGTGGG - Intergenic
936479880 2:112876468-112876490 CCTGGACAGCACCAGGCAATGGG + Intergenic
937428079 2:121816409-121816431 CCTGGCCACCATCAGGGAGAAGG + Intergenic
937646320 2:124269549-124269571 CATGATAAGCACCAGGGAGAGGG + Intronic
942244957 2:173999327-173999349 CCTGGTCAGAACCAGGGAGAAGG - Intergenic
943756459 2:191561920-191561942 CCTGCCCATCACCAGAGAGAGGG - Intergenic
944139501 2:196439703-196439725 CCTGACCAACAGTAGGGAGTGGG + Intronic
945920725 2:215752299-215752321 CCTCAGCATCACCTGGGAGTTGG + Intergenic
946534445 2:220610689-220610711 CCTGCACAGCCCCAGGAAGTAGG - Intergenic
947464290 2:230327164-230327186 CCTGACCCGGAGCAGGAAGTCGG - Exonic
948594694 2:239072448-239072470 GCTGAGCAGCTCCAGGAAGTAGG - Intronic
948773764 2:240269410-240269432 CCTGACCAGGAGCAAGGAGCTGG - Intergenic
1168798049 20:625010-625032 CCTGAACAGCACCTGGCATTTGG - Intergenic
1169343135 20:4811021-4811043 CCAGAGCAGCGGCAGGGAGTGGG + Intronic
1170536294 20:17344280-17344302 CCTCCCCAGCACCAGGCAGCTGG - Intronic
1171380801 20:24732638-24732660 CCTGAGCAGGACTGGGGAGTGGG - Intergenic
1173379975 20:42531455-42531477 CCTAACCAGCACCAGTGAGTCGG - Intronic
1173896483 20:46554888-46554910 CCTGCCCTGCACCCGGGAGGTGG + Intergenic
1175178990 20:57131694-57131716 CCTGAGGAGCACCAGGGTGAGGG - Intergenic
1175682714 20:61002601-61002623 CCTGACCATCACCTGATAGTTGG - Intergenic
1175943800 20:62549732-62549754 CCCGTCCAGCACCCGGGATTGGG + Intergenic
1179049679 21:37878602-37878624 CCTTACCAGCACCAGAAAGTAGG + Intronic
1179943733 21:44656273-44656295 CCTGACCTGCAGGAAGGAGTAGG - Intronic
1181968162 22:26671134-26671156 GCTGACCAGAACCAGGCAGGGGG + Intergenic
1182102953 22:27670633-27670655 CCTGCCCAGAGCCAGGGGGTTGG + Intergenic
1182891285 22:33820820-33820842 CCTGAGCAGCAGCAGGGACAAGG - Intronic
1183489784 22:38110261-38110283 CTTGTCCAGCATCTGGGAGTTGG + Intronic
950018501 3:9770085-9770107 TCTGACCAGAAGCAGGGAGATGG - Intronic
950636386 3:14318159-14318181 ACTGACCAGGACCAGTGAGCTGG + Intergenic
953925033 3:46978485-46978507 CCTGCCCAACACCAGGGGTTGGG + Intronic
954201328 3:49025071-49025093 CCTAAGCAGCACTAGGGAGGGGG + Intronic
958421756 3:93938732-93938754 CGTGACCAGCACCAGAGTTTTGG - Intronic
967480406 3:189966248-189966270 CCTGACCAGCACCAGGGAGTGGG - Intronic
968712173 4:2127050-2127072 GCTGCCCAGCACCTGGGGGTGGG - Intronic
969430486 4:7150953-7150975 CCTGACCACCACGAGTGAGGTGG - Intergenic
969714818 4:8863379-8863401 GGTGAGCAGCACCAGGGAGGCGG - Intronic
982104002 4:151996081-151996103 CCTGATCAGAACCAGGTACTTGG - Intergenic
982317666 4:154047941-154047963 CCTGACCAGCTCCATGAAATAGG - Intergenic
985435477 4:189926601-189926623 TGTGACCAGCACCAGGGTTTTGG - Intergenic
985447961 4:190038001-190038023 CCTGAGGAGCACCAGGGGGCCGG - Intergenic
988855986 5:35228824-35228846 CCCAACCAGCAGCAAGGAGTTGG + Intronic
991049414 5:62256440-62256462 CCTAACCAGCACCAGCTGGTTGG - Intergenic
991091274 5:62696138-62696160 CCAGGGCAGCAGCAGGGAGTAGG + Intergenic
992581511 5:78183058-78183080 CCTGACAACCACCAGGGTGTGGG - Intronic
996347492 5:122502649-122502671 CCTGACCAGCACAAGTCATTAGG - Intergenic
996453507 5:123655065-123655087 CATGAGCATCACCGGGGAGTGGG - Intergenic
997389536 5:133502571-133502593 CATGAACAGCACTGGGGAGTTGG - Intronic
997767189 5:136516407-136516429 CCAGACCAGAACCAGGGTGATGG - Intergenic
1000438323 5:161240684-161240706 CGTGACCAGCACCAGAGTTTTGG - Intergenic
1002321093 5:178376457-178376479 TCTCCCCAGCACCAGGCAGTGGG - Intronic
1002846548 6:950907-950929 ACTGAACAGCACCAGGAGGTAGG - Intergenic
1004900670 6:20190851-20190873 CCTGACCACCACCAGGGACAGGG + Intronic
1005666303 6:28060726-28060748 CCTTACGAGCAACAGGGAGAGGG + Intergenic
1005834113 6:29695037-29695059 CCTGCTCAGCACCAGAGAGGGGG + Intergenic
1006336736 6:33425034-33425056 CCTGAACAGACGCAGGGAGTTGG + Intronic
1007082119 6:39115011-39115033 CCTGACTGGCAGCAGGGGGTTGG + Exonic
1008562139 6:52733887-52733909 CCCTACCACCAGCAGGGAGTGGG - Intergenic
1008760344 6:54846440-54846462 CCAGACCAGGAGCAGGGTGTCGG + Intergenic
1010057840 6:71586337-71586359 CCTGACCAGGATCATTGAGTCGG - Intergenic
1013698420 6:112731756-112731778 TCTCACCAGCACAAGGGAGGTGG + Intergenic
1015350178 6:132209548-132209570 CCTGCTCAGCCCCAGGGTGTGGG + Intergenic
1017119081 6:151006976-151006998 CCTGATTAGTACCGGGGAGTGGG - Intronic
1017452567 6:154567387-154567409 CCTGACTACCACAAGGAAGTTGG + Intergenic
1018136559 6:160783789-160783811 CTTGACAAGCACCAGGAAGGCGG + Intergenic
1018660895 6:166086629-166086651 CCTCAGCATCACCAGGGAGCTGG - Intergenic
1019003553 6:168777474-168777496 GCTGACCCGCTCCAGGCAGTTGG + Intergenic
1019308891 7:349379-349401 CCTGACCTGCACCAAGGACCGGG + Intergenic
1020361019 7:7326771-7326793 ACTGACCAGCCCTTGGGAGTGGG + Intergenic
1021351691 7:19602135-19602157 CCTGTTCAGCCCAAGGGAGTGGG + Intergenic
1021857653 7:24873220-24873242 CTGAACCAGCACCAGGGAGCAGG + Intronic
1022766686 7:33420449-33420471 CCTGACCAGCACCAGACACGGGG + Intronic
1023734139 7:43219999-43220021 CTGGCCCAGCACCAGGTAGTTGG - Intronic
1025015434 7:55435489-55435511 GCTGACAGGCACCAGGGACTTGG - Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1025997776 7:66539004-66539026 CCTGACCACCTCCAGAGTGTGGG - Intergenic
1029020209 7:97357220-97357242 GCTGAGCAGCAGCAAGGAGTGGG + Intergenic
1030315264 7:108107686-108107708 TCTGGCCAGGCCCAGGGAGTGGG - Exonic
1032778645 7:135143710-135143732 CCTGCCCACCACTGGGGAGTGGG - Intronic
1032874518 7:136023345-136023367 CATGACTAGCACCAGGGAAATGG + Intergenic
1034424263 7:151006481-151006503 CCGGAACAGCACAAGTGAGTTGG + Exonic
1035588986 8:798783-798805 CCTGGCCAGCACCAGGGCACGGG - Intergenic
1036655628 8:10675303-10675325 CCTGCACAGGGCCAGGGAGTGGG - Intronic
1036699758 8:11004580-11004602 CCAGGCCAGCAACAGGGAGCTGG + Intronic
1037703865 8:21298531-21298553 ACTGTCCAGCACCAGAGAGCTGG - Intergenic
1038337002 8:26653436-26653458 CCTCGCCAGCACCAGCGAGCTGG - Intronic
1044954268 8:97463179-97463201 ACTGAGCAGAACCAGGAAGTGGG - Intergenic
1045327359 8:101126923-101126945 TGTGACCAGCATCAGGGAGGCGG - Intergenic
1046073090 8:109282177-109282199 CCTGCTCAGCCCCGGGGAGTAGG - Intronic
1047937472 8:129797012-129797034 CTTGACCACCAGCAGGGAGGTGG + Intergenic
1048713014 8:137233108-137233130 CTCGACCAGAACCAGTGAGTTGG + Intergenic
1048866179 8:138763506-138763528 ACACACCAGCACCTGGGAGTTGG - Intronic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1050362484 9:4843805-4843827 CCTGACCAGCAGAAGTGAGAGGG - Intronic
1050535945 9:6630905-6630927 CTTGACAAGTAACAGGGAGTTGG - Intronic
1051589058 9:18757604-18757626 CTTGACCAGCACAGGGGAGTGGG - Intronic
1053044620 9:34904994-34905016 CCTGACCAGCAGGTGGGAGTAGG + Intergenic
1057605043 9:96492998-96493020 TCTGACCAGCACAAGGAAGGAGG - Intronic
1060744677 9:126123428-126123450 CTTGGCCAGCAGCTGGGAGTTGG + Intergenic
1061374982 9:130218915-130218937 CCTTACAAGCACCTGGGAGCTGG + Intronic
1185602912 X:1352429-1352451 CCTGCCCCGCACCAGGATGTGGG - Exonic
1189954102 X:46260800-46260822 CCTGCCCAGCAGCAGGGGATAGG + Intergenic
1191044128 X:56117957-56117979 CCATACCAGGACCAGGAAGTGGG - Intergenic
1197874823 X:131091574-131091596 CCTAACCAGCCTCAGGGACTGGG + Intergenic
1197910623 X:131479444-131479466 CCTGACCAGAACTTGGGAGAGGG + Intergenic
1197971573 X:132120376-132120398 CCTCCCCAGCACCAGGCAGCAGG + Intronic
1199286122 X:146056434-146056456 CCTGACCTGAACAAGGGAGTGGG + Intergenic
1199742045 X:150745031-150745053 CCTGACCAGCTCAAGGGAAGGGG - Intronic