ID: 967481366

View in Genome Browser
Species Human (GRCh38)
Location 3:189977094-189977116
Sequence CATCGTAAAGTCTCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967481366 Original CRISPR CATCGTAAAGTCTCTGCTGC AGG (reversed) Intronic
901171996 1:7266038-7266060 AATATTAAAGTCTCTGCTGGTGG + Intronic
902302784 1:15514318-15514340 CTTATTAAAGGCTCTGCTGCTGG + Intronic
902530127 1:17085570-17085592 CGTCCAAAAGTTTCTGCTGCCGG - Intronic
913115752 1:115695306-115695328 AATCGCAGGGTCTCTGCTGCAGG - Exonic
913344585 1:117795534-117795556 CATGGTTACGGCTCTGCTGCTGG + Intergenic
918236262 1:182583312-182583334 CATCTTGAAAGCTCTGCTGCGGG + Intronic
918765116 1:188472066-188472088 CATCCAAAAGTCTCTGCTATGGG + Intergenic
919383967 1:196896276-196896298 CAACCTAAAGTCTATGCTACAGG - Intronic
1068385273 10:56317928-56317950 CAGTGAAAATTCTCTGCTGCTGG - Intergenic
1077864989 11:6214732-6214754 CAGTGTCAAGTCCCTGCTGCAGG - Exonic
1083215006 11:61212985-61213007 CATCATGAAGTGTCAGCTGCTGG - Exonic
1083217890 11:61231814-61231836 CATCATGAAGTGTCAGCTGCTGG - Exonic
1083220880 11:61251564-61251586 CATCATGAAGTGTCAGCTGCTGG - Intergenic
1088610306 11:111570127-111570149 CATGGTAAAGTGTATGCTGCAGG - Intergenic
1088893907 11:114063924-114063946 CATAGGACAGTCTCTCCTGCAGG + Exonic
1092006904 12:5077689-5077711 GACTGTAAAGTCTATGCTGCAGG + Intergenic
1099933659 12:89101122-89101144 CAACGTAATGACTCTTCTGCGGG - Intergenic
1099946436 12:89250037-89250059 CATAGTGAAGTCTCTTCTGTAGG - Intergenic
1101440573 12:104701627-104701649 CATCCTAAAGTCTCACCTGGAGG - Intronic
1102168161 12:110822393-110822415 CATCTTATAGTCTTGGCTGCGGG + Intergenic
1108119813 13:47172422-47172444 CATCATAATGTCTCTACTGCAGG - Intergenic
1110370668 13:74736818-74736840 CAGCCTAAAGTCTCTGCTTGGGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113847161 13:113398981-113399003 CATCCCAAAGCCTCGGCTGCCGG + Intergenic
1125889617 15:43255772-43255794 CTTCCTGAAGTCCCTGCTGCAGG + Intronic
1128710619 15:69868699-69868721 CAACTAAAAATCTCTGCTGCAGG + Intergenic
1133285049 16:4686781-4686803 CGTCCTAACGTGTCTGCTGCAGG - Intronic
1140248383 16:73271665-73271687 GATGGTTAAGTTTCTGCTGCAGG + Intergenic
1143374649 17:6460074-6460096 GATCATAAATTCTCTGCTGAGGG - Intronic
1147974734 17:44240251-44240273 CAACCTAAAGTCTCTGCTTCTGG + Intergenic
1152448385 17:80360369-80360391 CATTTTAAAGTTTCTGCTGAAGG + Intronic
1155244573 18:23894968-23894990 CCTGGTCAAGTCTCAGCTGCAGG + Exonic
1155524418 18:26702030-26702052 CATCTGAAAGTGTCTTCTGCTGG - Intergenic
925588932 2:5491060-5491082 CATCGTCCAGTCTCTGCTTTCGG - Intergenic
930631036 2:53755684-53755706 CATTATGAAGTCTCTGCTGAGGG - Intronic
932010400 2:67971972-67971994 CATCCTAAAGGCACTGCAGCAGG + Intergenic
932038614 2:68274508-68274530 CATCATAAAGCCTCTGCAGTTGG + Intergenic
932824748 2:74929032-74929054 AATTGTAAAGTCTCTGATGCTGG + Intergenic
934140816 2:89045777-89045799 CATTGTAATGTCTGTGCAGCTGG + Intergenic
934473414 2:94576577-94576599 CATCGTGAGGTCCCTGCAGCAGG - Intergenic
934559949 2:95307851-95307873 CATCACAAATTCTTTGCTGCAGG - Intronic
935360557 2:102243250-102243272 CATTGTACCTTCTCTGCTGCTGG + Intergenic
1175006910 20:55693841-55693863 AATAGTAATGTGTCTGCTGCAGG + Intergenic
1177057976 21:16333500-16333522 CATCGTAAATTGTCTGGTGAGGG + Intergenic
1179091141 21:38266886-38266908 CACCCTTAAGCCTCTGCTGCAGG + Intronic
1183307556 22:37090756-37090778 CATCCTACAGCCTCTGCTGGCGG - Intronic
960290170 3:115874502-115874524 ATTTGTAAAGTCTCTGCTCCAGG + Intronic
964379891 3:156087652-156087674 CATCGCACAGCCCCTGCTGCAGG + Intronic
966892236 3:184415962-184415984 CATCGTAAAGGCTCTGAGGATGG - Intronic
967481366 3:189977094-189977116 CATCGTAAAGTCTCTGCTGCAGG - Intronic
972885344 4:43479010-43479032 CATAGTCACGTCTCTGCTACTGG + Intergenic
975776526 4:77793540-77793562 CATGATGTAGTCTCTGCTGCTGG - Intronic
977553383 4:98465482-98465504 CATAATAAAGCCTATGCTGCTGG - Intergenic
978003299 4:103583955-103583977 CATAGAAAATTCTCTGCTCCAGG + Intergenic
998019032 5:138754004-138754026 CATCGGGAAGTCTCAGCGGCCGG - Intronic
1008302043 6:49853253-49853275 CCTCTCAAAATCTCTGCTGCAGG + Intronic
1014726475 6:124977733-124977755 TATCATAAAGTGTCTGCTTCTGG + Intronic
1015385606 6:132619611-132619633 CATTGTAGAATCTCTGCTGCAGG - Intronic
1017123569 6:151045811-151045833 CATCGTGAGGTCCCTGCCGCAGG + Intronic
1018369182 6:163151386-163151408 CATCGTGAAGTGTGTGTTGCTGG - Intronic
1024326014 7:48109744-48109766 CATGCTAAAGGCTCTGCTCCTGG + Intergenic
1032888044 7:136163385-136163407 CATCATACAGTCTCTCCTGGAGG - Intergenic
1036916730 8:12811412-12811434 CATGGTAAACTCTCAGCTTCTGG - Intergenic
1040441242 8:47445065-47445087 CATAGTAGAGTCTCTGCAGCTGG + Intronic
1049320485 8:141993633-141993655 GATCCACAAGTCTCTGCTGCTGG + Intergenic
1049545900 8:143230397-143230419 CCCCGTGAGGTCTCTGCTGCTGG - Intergenic
1050681655 9:8118475-8118497 CTTATTACAGTCTCTGCTGCTGG + Intergenic
1053934881 9:43140208-43140230 CATCGTGAGGTCCCTGCAGCAGG + Intergenic
1055118205 9:72627962-72627984 CATCTGAAAATCTCTGCTGGGGG + Exonic
1059935226 9:119303767-119303789 CATCTCAGAGTCCCTGCTGCTGG + Intronic
1062592286 9:137279766-137279788 CATCGTGCCGTTTCTGCTGCTGG + Exonic
1186045005 X:5526255-5526277 CAGCCTAAACTATCTGCTGCAGG - Intergenic
1195746555 X:108124210-108124232 CATCTTAGCCTCTCTGCTGCTGG - Intronic