ID: 967485342

View in Genome Browser
Species Human (GRCh38)
Location 3:190023609-190023631
Sequence TCTCCCTTGACATGGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967485332_967485342 5 Left 967485332 3:190023581-190023603 CCCATGACTCAATTACCTCCACC 0: 9
1: 415
2: 2063
3: 5890
4: 8349
Right 967485342 3:190023609-190023631 TCTCCCTTGACATGGGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 76
967485335_967485342 -10 Left 967485335 3:190023596-190023618 CCTCCACCTGGTCTCTCCCTTGA 0: 354
1: 448
2: 514
3: 596
4: 813
Right 967485342 3:190023609-190023631 TCTCCCTTGACATGGGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 76
967485330_967485342 7 Left 967485330 3:190023579-190023601 CCCCCATGACTCAATTACCTCCA 0: 13
1: 477
2: 4789
3: 7964
4: 10769
Right 967485342 3:190023609-190023631 TCTCCCTTGACATGGGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 76
967485331_967485342 6 Left 967485331 3:190023580-190023602 CCCCATGACTCAATTACCTCCAC 0: 10
1: 403
2: 2101
3: 5973
4: 8986
Right 967485342 3:190023609-190023631 TCTCCCTTGACATGGGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 76
967485333_967485342 4 Left 967485333 3:190023582-190023604 CCATGACTCAATTACCTCCACCT 0: 9
1: 441
2: 2074
3: 4091
4: 6938
Right 967485342 3:190023609-190023631 TCTCCCTTGACATGGGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967485342 Original CRISPR TCTCCCTTGACATGGGCGGC GGG Intronic