ID: 967493633

View in Genome Browser
Species Human (GRCh38)
Location 3:190120387-190120409
Sequence CCCTTTTCCGCTCCTTGTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967493633_967493658 27 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493658 3:190120437-190120459 GGGGCGGGGGCGGGAGCGGGTGG 0: 2
1: 19
2: 114
3: 836
4: 5090
967493633_967493645 8 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493645 3:190120418-190120440 GCGCCGGGGCCCTCGCCGGGGGG 0: 1
1: 1
2: 4
3: 18
4: 222
967493633_967493657 24 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493657 3:190120434-190120456 CGGGGGGCGGGGGCGGGAGCGGG 0: 1
1: 11
2: 78
3: 631
4: 3375
967493633_967493642 5 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493642 3:190120415-190120437 TCAGCGCCGGGGCCCTCGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 150
967493633_967493649 13 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493649 3:190120423-190120445 GGGGCCCTCGCCGGGGGGCGGGG 0: 1
1: 0
2: 1
3: 48
4: 402
967493633_967493641 4 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493641 3:190120414-190120436 CTCAGCGCCGGGGCCCTCGCCGG 0: 1
1: 0
2: 1
3: 13
4: 162
967493633_967493640 -6 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493640 3:190120404-190120426 AAAGGGGCAGCTCAGCGCCGGGG 0: 1
1: 0
2: 2
3: 8
4: 111
967493633_967493650 14 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493650 3:190120424-190120446 GGGCCCTCGCCGGGGGGCGGGGG 0: 1
1: 0
2: 1
3: 42
4: 445
967493633_967493652 17 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493652 3:190120427-190120449 CCCTCGCCGGGGGGCGGGGGCGG 0: 1
1: 1
2: 6
3: 84
4: 678
967493633_967493647 11 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493647 3:190120421-190120443 CCGGGGCCCTCGCCGGGGGGCGG 0: 1
1: 0
2: 0
3: 24
4: 312
967493633_967493648 12 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493648 3:190120422-190120444 CGGGGCCCTCGCCGGGGGGCGGG 0: 1
1: 1
2: 1
3: 30
4: 365
967493633_967493639 -7 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493639 3:190120403-190120425 AAAAGGGGCAGCTCAGCGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 211
967493633_967493656 23 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493656 3:190120433-190120455 CCGGGGGGCGGGGGCGGGAGCGG 0: 1
1: 3
2: 40
3: 483
4: 3122
967493633_967493643 6 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493643 3:190120416-190120438 CAGCGCCGGGGCCCTCGCCGGGG 0: 1
1: 0
2: 2
3: 22
4: 226
967493633_967493654 18 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493654 3:190120428-190120450 CCTCGCCGGGGGGCGGGGGCGGG 0: 1
1: 0
2: 2
3: 102
4: 827
967493633_967493644 7 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493644 3:190120417-190120439 AGCGCCGGGGCCCTCGCCGGGGG 0: 1
1: 0
2: 2
3: 14
4: 122
967493633_967493638 -8 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493638 3:190120402-190120424 GAAAAGGGGCAGCTCAGCGCCGG 0: 1
1: 0
2: 1
3: 25
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967493633 Original CRISPR CCCTTTTCCGCTCCTTGTTG GGG (reversed) Exonic
902596765 1:17514972-17514994 CCCTTTCCAGCTTCTTTTTGCGG + Intergenic
903040270 1:20524265-20524287 CCCTTTTCTGCCTCTGGTTGAGG + Intergenic
905544555 1:38787250-38787272 CCCTTGCCCGTTCCTTCTTGTGG - Intergenic
909950693 1:81716711-81716733 CCCTTTTATGCTCCTTTTGGTGG - Intronic
910870859 1:91831497-91831519 CCATTTTCCTTTCCTTGTAGTGG - Intronic
912532939 1:110339530-110339552 CTCTTTTCCCTTCATTGTTGCGG - Exonic
915033628 1:152904920-152904942 CCCCTTTGGGCTCATTGTTGGGG - Intergenic
916777634 1:167984271-167984293 CACTTTTCCCCTCCTTCTTGAGG + Intronic
918647570 1:186920719-186920741 CCCTTTTCCTCTCCTTTCAGGGG + Intronic
920035341 1:203061559-203061581 TCTTTTTCCTCTCCTTGATGGGG + Intronic
922796134 1:228340732-228340754 GTCTGTTCCGCGCCTTGTTGCGG - Exonic
1063021937 10:2137632-2137654 GCCTTTTCCTCTCCCTGGTGAGG + Intergenic
1063620054 10:7638221-7638243 CCCTTTTCCCTTCCATCTTGTGG - Intronic
1067512319 10:46906312-46906334 CCTCTTTCCCCTCCTTGTGGAGG + Intergenic
1067649924 10:48145510-48145532 CCTCTTTCCCCTCCTTGTGGAGG - Intergenic
1068542744 10:58313486-58313508 ACCTTCTCTGCTCCCTGTTGTGG - Intergenic
1071036888 10:81258367-81258389 CCCCTTTTCTCTCCTTTTTGGGG - Intergenic
1071281867 10:84110833-84110855 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1072866706 10:99069899-99069921 CACTTTCCCTCTCCTTGTTATGG - Intronic
1073850122 10:107605535-107605557 CCCTGTTCTGCCCCTTGTCGGGG - Intergenic
1076161927 10:128251047-128251069 CCCTTTACAAGTCCTTGTTGAGG + Intergenic
1076655322 10:132019796-132019818 CTCTTGTCTGCTCCTTGTAGTGG + Intergenic
1079296325 11:19237904-19237926 CCCTTTTCTGATCTCTGTTGCGG + Exonic
1079389437 11:20008429-20008451 CTCTTTTCAGCTACTTCTTGAGG + Intronic
1085463460 11:76708911-76708933 CCCTTTTTGGCTTCTTGTTGGGG + Intergenic
1089321473 11:117629485-117629507 CCCTTGTCTGCTGCTTCTTGGGG - Intronic
1097242077 12:57582396-57582418 CCCTTTTCCTCTCCTTGGTGAGG + Intronic
1099601783 12:84748888-84748910 CCCTTTTAAGCTCCCTGTTTTGG + Intergenic
1102409856 12:112708312-112708334 CCCTTTTCCCCTCCTGGTCCTGG - Intronic
1103150307 12:118632549-118632571 TCCTCTTCCACTCCTTCTTGTGG + Intergenic
1103406642 12:120680549-120680571 CCCATTTCCCCTCCCTGCTGTGG - Intergenic
1103732426 12:123036784-123036806 CCCTGTTCCCCTCCTTGGGGTGG + Intronic
1104607527 12:130200927-130200949 CCATTTTCCGTACCTGGTTGGGG - Intergenic
1105848293 13:24311875-24311897 CCCTTTCCCGCTTCCTGTGGGGG - Intronic
1109802646 13:67399575-67399597 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1113407347 13:110053928-110053950 ACCTTTTCCCCTCCTGGTTATGG + Intergenic
1114487074 14:23069257-23069279 TCATTTTCCTTTCCTTGTTGGGG - Intronic
1115033117 14:28822375-28822397 CCATTTTGAGCTCCTTTTTGTGG - Intergenic
1123682269 15:22771253-22771275 TCCTTTTTAGCTCCTTGATGTGG + Intergenic
1124334021 15:28843766-28843788 TCCTTTTTAGCTCCTTGATGTGG + Intergenic
1127871586 15:63078334-63078356 CCCTTTTGCTCTCCTTGTTTTGG + Intergenic
1129945079 15:79532782-79532804 GCCTTTTCTTCTCCTTGTTTCGG - Intergenic
1134066325 16:11230759-11230781 CCCTATTCTGATCCTTCTTGGGG + Intergenic
1139474776 16:67197720-67197742 CCCTTTTGAGGACCTTGTTGTGG + Intronic
1149305544 17:55343393-55343415 TCCTTTTCCTGCCCTTGTTGGGG - Intergenic
1150006496 17:61472847-61472869 CCCCTTTCCTCCCCTGGTTGAGG + Intronic
1150488602 17:65560355-65560377 CCCTTTTCCCCTCCCTGCCGCGG - Intronic
1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG + Intronic
1152884643 17:82842397-82842419 CCCTTCTCCACTCCTGGTCGAGG + Intronic
1156437269 18:37146041-37146063 TCCTTTTCTGCTCCTTTTTTTGG + Intronic
1161980779 19:7629214-7629236 CCCATTTCCGCCCCTGGTTCGGG + Intronic
1162284561 19:9728496-9728518 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
1162532842 19:11245763-11245785 CCCCTTCCTTCTCCTTGTTGGGG - Intronic
1163772024 19:19197064-19197086 TCCTACTCCTCTCCTTGTTGGGG - Intronic
1163943565 19:20516178-20516200 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
1165147126 19:33738053-33738075 CCCTTTTCCCATTCTTGATGAGG + Intronic
928025567 2:27736098-27736120 ACCTTTCCCCCTCCCTGTTGGGG + Intergenic
929000607 2:37344389-37344411 CCCTTTTCTGTTCCCTGTTTTGG + Intergenic
930046507 2:47177018-47177040 CACTTTCCCGCCCCTTATTGAGG + Intergenic
934078817 2:88451072-88451094 CCCCTTTCCTTTCCTTGTTCTGG + Intronic
934898333 2:98138278-98138300 CCCTTTTAGGCTGCTTGTTGAGG + Intronic
937043800 2:118840221-118840243 CCCTTCTCCCCTCCCTATTGTGG - Intergenic
937391001 2:121486221-121486243 ACCTTTTCAGTTCCTTTTTGAGG - Intronic
937882001 2:126875384-126875406 CCCTTTTCCCTCCCTTGTTTAGG + Intergenic
945690396 2:213027080-213027102 CCATTTTCAGCTCCTTCTTTTGG + Intronic
946428314 2:219611671-219611693 CCTGTTTCCGCTCCCTGTTGGGG - Exonic
946813591 2:223552898-223552920 CCCTTTTTCCCTCCTTATTATGG - Intergenic
948371632 2:237493409-237493431 CCCATTTCTGCTTCTTGTCGGGG - Exonic
1170023697 20:11865240-11865262 CCCTTTTCAGCTTCTTTTTCTGG - Intergenic
1173425481 20:42939452-42939474 TCCTTTTCCTTTCCTTCTTGAGG + Intronic
1175010268 20:55727683-55727705 TACTTTTCTGTTCCTTGTTGTGG - Intergenic
1175107435 20:56625477-56625499 GCCTTCTCCGCTCCGTGTTCTGG - Intergenic
1176417252 21:6483856-6483878 CCCTGCTCTGCTCCTTGTGGGGG - Intergenic
1179692748 21:43092189-43092211 CCCTGCTCTGCTCCTTGTGGGGG - Intergenic
1183560591 22:38569954-38569976 CCCTTTCTCGCTCCTTTTTTGGG - Intronic
1184339397 22:43877892-43877914 CCCTTTTCTGCTCCATAATGTGG + Intergenic
949498351 3:4654918-4654940 CCCTTTTGTGCTCCTTACTGGGG + Intronic
950216332 3:11162336-11162358 GCATTTTCCTCTCCTTGGTGGGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950671323 3:14527492-14527514 CCTTTTTCAGGTCCTGGTTGGGG - Intronic
953216819 3:40926398-40926420 CCCTTTACCACTCCTTGTGAAGG + Intergenic
963398032 3:144757812-144757834 CCTTTTGCCGCTCCTGGCTGGGG - Intergenic
963443139 3:145366971-145366993 ACTGTTTCCCCTCCTTGTTGTGG + Intergenic
964522773 3:157585594-157585616 CCCTTTCCCTCTCCTTCTGGGGG + Intronic
966963302 3:184963338-184963360 GCCTTTTCTGCTCTTTGGTGAGG + Intronic
967378047 3:188827604-188827626 CTCTGTTCCACTCCCTGTTGTGG - Intronic
967493633 3:190120387-190120409 CCCTTTTCCGCTCCTTGTTGGGG - Exonic
968006552 3:195247151-195247173 ACCTCTTCCCCTCCTTTTTGGGG - Intronic
968166400 3:196468871-196468893 CCTTTTTCCTCTCATTTTTGTGG - Exonic
970500102 4:16668304-16668326 GCCTGTTCCCCTCCTGGTTGAGG + Intronic
977404153 4:96575045-96575067 CTCTTTTCCCCTCCTTCTTTAGG + Intergenic
978328705 4:107587738-107587760 CCCTTTTCTCTCCCTTGTTGGGG - Intergenic
979287925 4:118947570-118947592 CCCTCTTCCTCTCCCTGTCGGGG + Intronic
983957572 4:173715854-173715876 CCATTTTCCCCTCCTGGTTGGGG + Intergenic
986077846 5:4356694-4356716 CCCTTTTCCCCTTTTAGTTGAGG - Intergenic
986392888 5:7301785-7301807 TCCTTTTTAGCTCCTTGATGTGG + Intergenic
988847696 5:35145492-35145514 CCCTTTGAAGGTCCTTGTTGTGG + Intronic
990862571 5:60343335-60343357 CCCTTTTCCGGGCCCTGCTGTGG - Intronic
995163073 5:109004475-109004497 TCATTTACAGCTCCTTGTTGTGG - Intronic
996403813 5:123088422-123088444 CTCTTTCCCTCTCCTTCTTGGGG - Intergenic
998704098 5:144738964-144738986 CCCTTTTCCACTTTTTGATGAGG - Intergenic
1001670321 5:173468282-173468304 CCCTTGAAAGCTCCTTGTTGTGG + Intergenic
1004910865 6:20281807-20281829 CCCTTTTCCACTTCTGGTTCTGG - Intergenic
1006931557 6:37692082-37692104 CCCTTTTCAGCCCCAGGTTGAGG + Intronic
1007002034 6:38322633-38322655 CCATTTACCGCTCCATTTTGGGG + Intronic
1007929582 6:45678323-45678345 CTCTTTTCCGCTCCTTGGCCTGG + Intergenic
1008747009 6:54684294-54684316 CCCTTTTACTCTCTTTGTTTTGG + Intergenic
1010178345 6:73055606-73055628 CCCATTTCCCCTCCTTGATCTGG - Intronic
1013680729 6:112522538-112522560 AACTTTTCCCCTCCTTGTTTGGG + Intergenic
1014472758 6:121836446-121836468 CCCTTTTCCTTTCCCAGTTGTGG + Intergenic
1015446620 6:133312943-133312965 TCCTTTGCCTTTCCTTGTTGGGG + Intronic
1015652098 6:135474917-135474939 TCCTTGTCCACTCCTTTTTGTGG - Intronic
1019481049 7:1267053-1267075 CCCTGTCCCGCTCCTTGATGTGG + Intergenic
1025820319 7:64956306-64956328 CCTTTTTCCTCTCATTGATGTGG + Intergenic
1026348848 7:69498237-69498259 CCCATGTCCCCTCCTTGATGCGG - Intergenic
1026603073 7:71792757-71792779 CCCTTTTCCATTCCATCTTGAGG + Intronic
1027932489 7:84555069-84555091 CCTTTTTCAGCTATTTGTTGAGG + Intergenic
1030927602 7:115477414-115477436 CCCGTCTCGGCTCCTTTTTGGGG - Intergenic
1031300811 7:120059417-120059439 CCCTTTTAGCCTCCTGGTTGTGG + Intergenic
1039598207 8:38809768-38809790 CCCTTTTCCCCTCCTTCTGTAGG - Intronic
1042018576 8:64344753-64344775 CCCTTTTCCCCTCCATTTTCTGG - Intergenic
1042829117 8:73007905-73007927 CCGTTTTCTGTTCCTTGATGTGG - Intergenic
1043233288 8:77830099-77830121 GCCTTTTGAGCTCCTTGGTGAGG + Intergenic
1049614826 8:143571569-143571591 CCCTTTTCAGCTCCCTCTTCTGG + Intronic
1051346231 9:16153482-16153504 CCGTTTTCCCCTCCTTCTTAAGG + Intergenic
1055903206 9:81264517-81264539 CCCTTTTCCACTTTTTGTTTTGG - Intergenic
1185566216 X:1097385-1097407 CCCATTTCTGCTTCTTGCTGGGG + Intergenic
1185771593 X:2769116-2769138 GGCTTTGCCGCTCCTTGTGGAGG - Intronic
1186515693 X:10164848-10164870 CTCTTTCCCGCTTCTTGTCGTGG + Intronic
1189102420 X:38205159-38205181 CACATTTCTGCTCCTTGTAGAGG - Intronic
1193365717 X:80629865-80629887 CCCTTTCCATCTCCTTCTTGAGG - Intergenic