ID: 967493648

View in Genome Browser
Species Human (GRCh38)
Location 3:190120422-190120444
Sequence CGGGGCCCTCGCCGGGGGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 365}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967493630_967493648 16 Left 967493630 3:190120383-190120405 CCCGCCCCAACAAGGAGCGGAAA 0: 1
1: 0
2: 0
3: 7
4: 98
Right 967493648 3:190120422-190120444 CGGGGCCCTCGCCGGGGGGCGGG 0: 1
1: 1
2: 1
3: 30
4: 365
967493637_967493648 10 Left 967493637 3:190120389-190120411 CCAACAAGGAGCGGAAAAGGGGC 0: 1
1: 0
2: 0
3: 3
4: 122
Right 967493648 3:190120422-190120444 CGGGGCCCTCGCCGGGGGGCGGG 0: 1
1: 1
2: 1
3: 30
4: 365
967493633_967493648 12 Left 967493633 3:190120387-190120409 CCCCAACAAGGAGCGGAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 967493648 3:190120422-190120444 CGGGGCCCTCGCCGGGGGGCGGG 0: 1
1: 1
2: 1
3: 30
4: 365
967493631_967493648 15 Left 967493631 3:190120384-190120406 CCGCCCCAACAAGGAGCGGAAAA 0: 1
1: 0
2: 0
3: 15
4: 124
Right 967493648 3:190120422-190120444 CGGGGCCCTCGCCGGGGGGCGGG 0: 1
1: 1
2: 1
3: 30
4: 365
967493635_967493648 11 Left 967493635 3:190120388-190120410 CCCAACAAGGAGCGGAAAAGGGG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 967493648 3:190120422-190120444 CGGGGCCCTCGCCGGGGGGCGGG 0: 1
1: 1
2: 1
3: 30
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967493648 Original CRISPR CGGGGCCCTCGCCGGGGGGC GGG Exonic
900148439 1:1168163-1168185 CCGGCCCCTCCCCTGGGGGCTGG - Intergenic
900294144 1:1940222-1940244 GGGGGCCCTCGCCCGGGTGCTGG + Intronic
900302929 1:1986911-1986933 GGTGGCCCTCGCCAGGGGGCAGG - Intronic
900513020 1:3069330-3069352 CGGGGCCCGGGCCGCCGGGCCGG + Intronic
900651464 1:3732146-3732168 CGCGGCACTGGCTGGGGGGCAGG - Intronic
900799174 1:4727010-4727032 GGTGGCCCACGCCGGGGGGCTGG - Intronic
901332811 1:8423873-8423895 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
902509949 1:16961079-16961101 CCGGGCACTGGCCGCGGGGCTGG - Exonic
902542775 1:17166386-17166408 CAGGGCCCTGGCTTGGGGGCTGG + Intergenic
902813539 1:18902982-18903004 CGGGGCGCACGCCAGAGGGCCGG - Intronic
903216194 1:21844483-21844505 TGGGGCCATTGCCTGGGGGCGGG - Intronic
903652498 1:24930311-24930333 CGGGGCCCGCGGGGCGGGGCTGG + Intronic
904768969 1:32870626-32870648 GGGGGCCCGGGGCGGGGGGCCGG - Intronic
904822920 1:33256738-33256760 CGGGGGCCGGGCCGGGGCGCGGG + Intronic
904941112 1:34165303-34165325 CGGGGTTCGCGCCGGGGGGCGGG + Intronic
905027219 1:34859231-34859253 CCGGGCCCTCGCACTGGGGCAGG - Intronic
905202357 1:36323286-36323308 TGGGGACCTCACCAGGGGGCGGG - Intronic
906525224 1:46489774-46489796 CCGGGCCCGCGCCGGGCGCCCGG + Intergenic
907263304 1:53238310-53238332 CGGGGACCAGGCCTGGGGGCCGG - Intronic
907889464 1:58623461-58623483 CGGGGCGCTCGCCGGCCAGCTGG + Intergenic
912670520 1:111620083-111620105 CGGGGGCCTGGCCGGCGGGAGGG + Intronic
912796952 1:112699173-112699195 TGGGGCCCTGGCATGGGGGCGGG - Intronic
912927935 1:113929792-113929814 CGGGGACGGCTCCGGGGGGCGGG + Exonic
914869128 1:151458825-151458847 CGCGGCGGGCGCCGGGGGGCGGG + Intronic
915457602 1:156051144-156051166 GGGGGCCCTCTCCGGGGGCTGGG - Exonic
916084639 1:161259415-161259437 AGTGGCCCTCCCCGGGGGCCAGG - Intronic
916528198 1:165631215-165631237 CGGCGCCCTCGCCTGGGGCGGGG - Exonic
918276766 1:182960164-182960186 CGGGGGCCTGGCCGCGGGGATGG - Intergenic
919748650 1:201023560-201023582 CGGGCCCAGCCCCGGGGGGCCGG - Exonic
919892001 1:201982575-201982597 CGGGGCCCGCGCGGCGGGGGCGG + Intronic
922851357 1:228736003-228736025 CGGTGAGCTGGCCGGGGGGCCGG + Exonic
1062843901 10:690034-690056 CGGGGCCCGCGGGGCGGGGCGGG + Intergenic
1063417949 10:5889346-5889368 CTGGGCCATCGCCGCGGGTCGGG + Exonic
1063450018 10:6144969-6144991 GGGGGCGCTCCCCGCGGGGCCGG - Intronic
1065140355 10:22714018-22714040 GGGGGCACGCGCCGCGGGGCTGG + Intronic
1065287876 10:24202694-24202716 CAGGGACCTCCCTGGGGGGCAGG - Intronic
1067031054 10:42879094-42879116 CTGGGCCCTCCCAGGTGGGCCGG - Intergenic
1067544849 10:47185233-47185255 CGGGGCCCTGGCTGGGGTTCAGG - Intergenic
1070594262 10:77821312-77821334 CGGGGTCCACGTCAGGGGGCAGG + Exonic
1072003491 10:91220557-91220579 CGGGGGCGTGGCCGGGCGGCGGG + Intronic
1072102138 10:92239533-92239555 CGGGACCCTCGCCGGGCGGTCGG - Exonic
1072294200 10:93993881-93993903 CGGGGCCCCCGCCCTGGGCCGGG - Intergenic
1072726419 10:97816769-97816791 CTGGGCTCTGGCCAGGGGGCTGG + Intergenic
1072926286 10:99620211-99620233 CGGGGCGTGGGCCGGGGGGCCGG - Exonic
1073138037 10:101230312-101230334 CGGGGCCCCGGCCGGGGCCCGGG - Intergenic
1073214682 10:101829762-101829784 GGGGGCACTTGCCTGGGGGCTGG - Intronic
1075082517 10:119393329-119393351 CGGGGCCTCTGCCGGGAGGCAGG + Intronic
1075144557 10:119872458-119872480 CGGGGCCCTGCCCCGGGGCCCGG + Intronic
1075401383 10:122163732-122163754 CGCGGCCCGAGCCGGGGGCCGGG - Intronic
1075501727 10:122980711-122980733 CGGGGCCTGGGCCGCGGGGCGGG + Intronic
1075616134 10:123891866-123891888 CGGGGCGGGCGCAGGGGGGCCGG + Intronic
1075651147 10:124128948-124128970 TGGGGCCCTGGCCGGTGAGCTGG + Intergenic
1076864361 10:133159950-133159972 CGGGGCCCGGGGTGGGGGGCGGG - Intergenic
1076864374 10:133159969-133159991 CGGGGCCCGGGGTGGGGGGCGGG - Intergenic
1076885886 10:133262107-133262129 CGGGGCCGTTGCCGGGAGACGGG + Intergenic
1076992795 11:284485-284507 TGGAGCCCTCGCTGGGGGTCAGG - Exonic
1077100458 11:820061-820083 CGGGTCGCTGGCCTGGGGGCGGG + Intronic
1077184644 11:1230709-1230731 GGGGGACCTGGCCTGGGGGCTGG - Intronic
1077330776 11:1982978-1983000 CGGGGCCCAGGCTGGGGGGGTGG + Intronic
1077338708 11:2016632-2016654 CGGGGCCCTGGTGGGTGGGCAGG + Intergenic
1077480318 11:2811565-2811587 CGGGGCCCTTGCCGAGCGTCAGG + Intronic
1078509752 11:11976597-11976619 CGGGGCCCCAGCCAGGGGGCAGG + Intronic
1079076390 11:17387773-17387795 CAGTGCCCTCGCTGGGGGCCAGG + Exonic
1081831463 11:46119877-46119899 CCGCGCCCCCGCCGGGGGGAGGG - Intronic
1083329813 11:61892075-61892097 CGGAGCCCTCTGCTGGGGGCGGG + Intergenic
1084150414 11:67285574-67285596 CGGGCCCCTCCCGGGGGAGCTGG - Exonic
1084588766 11:70078494-70078516 CGGCGCGCTCGCAGGGGGCCGGG - Exonic
1085322269 11:75582562-75582584 CTGAGCCCAAGCCGGGGGGCTGG - Intergenic
1085503134 11:77040414-77040436 CAGGGCCCGGGCCGTGGGGCCGG - Exonic
1091273050 11:134331743-134331765 CGGGGCCCCGGCCGGGGGCGGGG - Intergenic
1091286572 11:134411774-134411796 CGGGGCGCCCGCGGGGGCGCGGG + Intronic
1202813756 11_KI270721v1_random:38157-38179 CGGGGCCCAGGCTGGGGGGGTGG + Intergenic
1202821692 11_KI270721v1_random:71814-71836 CGGGGCCCTGGTGGGTGGGCAGG + Intergenic
1091550281 12:1530963-1530985 CGGGGCCGTCCCCGGGGGCGAGG - Intronic
1091613983 12:2035149-2035171 CCGGGCCCTCCGCGGGGCGCCGG + Intronic
1091815916 12:3437884-3437906 CTGGGCCCTCGCCGTGTGTCAGG - Intronic
1092247940 12:6873596-6873618 CCGGGCCTTCGCCGTGGGGGCGG - Intronic
1092881606 12:12891510-12891532 GGCGGCCCTCGCCGGAGGGAGGG - Exonic
1093435472 12:19130206-19130228 CGGGGCCCGCGGCGCGGGGCAGG - Intronic
1093736413 12:22625314-22625336 GGGCGCCCTCGCGGGAGGGCTGG - Exonic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096773964 12:53953075-53953097 CGGGGCCGGCTCCTGGGGGCGGG + Intergenic
1096981268 12:55729165-55729187 CGTGGCCCTGGCCGGGCGGGGGG - Intronic
1097267543 12:57755032-57755054 CGGGGCGGGCGCCGGGGAGCGGG - Intronic
1097863942 12:64543531-64543553 AGGAGCCCACGGCGGGGGGCGGG - Intergenic
1100632303 12:96400616-96400638 CGGGGCCGGCGGCCGGGGGCGGG + Intergenic
1101469040 12:104977827-104977849 CGGGGGCCTGGCCGCGGGGATGG - Intergenic
1102482304 12:113232298-113232320 GGGGGCCCCTGCCAGGGGGCAGG - Intronic
1103074232 12:117969160-117969182 CGCGCACCTGGCCGGGGGGCGGG + Intergenic
1103342752 12:120229882-120229904 CGGGGCCCTGGCGCTGGGGCTGG - Intronic
1103698486 12:122835422-122835444 CGGGCTCCTCCCCGGCGGGCGGG + Exonic
1103705106 12:122867226-122867248 GGAGGCCCACGCGGGGGGGCAGG + Exonic
1104376336 12:128267582-128267604 CGGGGGCCTCGGCGGGGGCTCGG + Intronic
1105031479 12:132887400-132887422 CGGGGCCCGCGGGGTGGGGCGGG - Intronic
1106104184 13:26719367-26719389 CGGGGACCTCCCAGGGTGGCTGG - Intergenic
1111822300 13:93228182-93228204 AGGGACCCTCGCCGGGGACCTGG + Intronic
1112056188 13:95691298-95691320 CGGGGCACTTGCCGGGCGGAGGG + Intronic
1113217191 13:108055790-108055812 CGTGGCCCTAGCTGGGGGCCTGG + Intergenic
1113465874 13:110512617-110512639 CGGGGCCCTCGTGTGGGGACGGG - Exonic
1113473271 13:110561724-110561746 CGGAGCCCACGTCGGGGGCCCGG + Exonic
1113493941 13:110713613-110713635 CGGGGCCGTTGCCGGGGGAGGGG + Intronic
1113907438 13:113826408-113826430 CGAGGCCAGCGCCGGGAGGCCGG - Intronic
1113907449 13:113826447-113826469 CGAGGCCGGCGCCGGGAGGCTGG - Intronic
1113907462 13:113826486-113826508 CGAGGCCGGCGCCGGGAGGCCGG - Intronic
1113907475 13:113826525-113826547 CGAGGCCGGCGCCGGGAGGCCGG - Intronic
1113907488 13:113826564-113826586 CGAGGCCAGCGCCGGGAGGCCGG - Intronic
1113907500 13:113826603-113826625 CGAGGCCGGCGCCGGGAGGCCGG - Intronic
1114178255 14:20343195-20343217 CGGGCCCCTCCCCGAAGGGCGGG + Intergenic
1114259292 14:21025568-21025590 CGGGGGTCTCGCCGGCTGGCAGG + Intronic
1114626994 14:24136432-24136454 CGCCGCCCTCCCCGGGGCGCAGG - Intronic
1115217312 14:31026192-31026214 TGGGGCCCCGGCCGGGGCGCAGG + Exonic
1115641623 14:35339029-35339051 CAAGGCCCTCGCTGAGGGGCTGG - Intergenic
1118836983 14:69484646-69484668 TGGGGCTGTCGCCGGGGGGGTGG + Intergenic
1118992371 14:70808787-70808809 TGGGGTCCTCGCCGCCGGGCTGG + Exonic
1119539357 14:75428365-75428387 CGGGAGCCTCCCCGCGGGGCTGG - Intronic
1119821023 14:77616420-77616442 AGGGGCCCGCGCGGCGGGGCCGG - Intronic
1120178956 14:81324038-81324060 CCGGACCCTCGCCGGGGTTCTGG + Intronic
1120834443 14:89027392-89027414 CGGGTCCCGCGCCGCGGAGCCGG - Intergenic
1121338777 14:93092848-93092870 CAGGGCCCAGGCCAGGGGGCTGG + Intronic
1121703204 14:95971889-95971911 CGGGGCCCCCACGGGGGGACTGG + Intergenic
1122399564 14:101458767-101458789 CGGAGCCCTCCCGGGCGGGCGGG - Intergenic
1122889068 14:104724297-104724319 CGCCGCCTGCGCCGGGGGGCCGG - Intronic
1124328725 15:28789115-28789137 CTGTGCCCTCGCCGGCGGCCCGG + Intergenic
1124500443 15:30223296-30223318 CGGGGCCCGCGCCGGGGCCGGGG + Intergenic
1128705457 15:69834750-69834772 CGGTGGCCTGCCCGGGGGGCTGG + Intergenic
1129296586 15:74603428-74603450 CAGGGCCTGGGCCGGGGGGCAGG - Intronic
1129387394 15:75203280-75203302 CGGGACCCTGGCCTGGGTGCTGG + Intronic
1129672627 15:77615759-77615781 CGGAGCACTCGCAGCGGGGCGGG + Exonic
1129772039 15:78208609-78208631 GGAGGCCCTCACTGGGGGGCCGG - Intronic
1130959103 15:88648022-88648044 CCAGGCACTAGCCGGGGGGCGGG + Intronic
1132055342 15:98647746-98647768 CGGGGCCCGCGAGGGGCGGCGGG + Intergenic
1132105486 15:99059529-99059551 CGGGGACCCCGGCGGGGGCCAGG + Intergenic
1132128472 15:99251595-99251617 GGGCGTCCCCGCCGGGGGGCCGG - Intronic
1132512950 16:353054-353076 CGGGGCCTCCGGCGCGGGGCGGG + Intergenic
1132550643 16:552608-552630 CGGGACCCCTGCCGAGGGGCTGG - Exonic
1132554247 16:565671-565693 CTGGGCCCTCCCCGCGGGGCTGG + Intergenic
1132593550 16:737621-737643 TGGGGCCCTGGACGGGGTGCTGG + Intronic
1132665361 16:1078963-1078985 CGGCGCCCTCGGCAGGGGCCCGG + Exonic
1132748143 16:1445483-1445505 CGGGTCCCTCCGTGGGGGGCTGG - Exonic
1133029657 16:3004381-3004403 CGGGGCTCAGGCCGGGCGGCAGG - Intergenic
1133249947 16:4474386-4474408 TGGGACCCGGGCCGGGGGGCGGG - Exonic
1133771311 16:8868609-8868631 CGGGGGACTCGCCGGGCGGTGGG - Intronic
1134014575 16:10879270-10879292 CGGGGCCGTGGGCGGGTGGCAGG + Intronic
1136287902 16:29254839-29254861 CGGGGGCCAGGCCGGGGGCCGGG - Intergenic
1136499794 16:30664524-30664546 TGGGGTCCTGGCCGGGGGGTGGG + Intronic
1136574960 16:31117900-31117922 CGGGGCCCAGGGCTGGGGGCGGG + Intronic
1138360829 16:56425657-56425679 CGGGCCTCAGGCCGGGGGGCGGG + Intergenic
1139511603 16:67431196-67431218 CGGGGGCCGGGCCGGGGAGCGGG - Exonic
1140475977 16:75239476-75239498 TGGGGCCCTTACCGGGAGGCTGG - Intronic
1141054837 16:80804749-80804771 CGGGGCCCCCGGGGGGCGGCGGG + Intergenic
1141464040 16:84195225-84195247 GGGGGCCCTTCCCAGGGGGCCGG - Intronic
1141677204 16:85524096-85524118 CGGGGCCCAGGTCTGGGGGCCGG + Intergenic
1142156308 16:88534229-88534251 CGGGGGCGTGGCCGGGCGGCGGG - Exonic
1142468338 17:148309-148331 CTGGGCCTCCGCCGGGGGCCAGG + Intronic
1142496679 17:309764-309786 CGGACCCCTGGCAGGGGGGCTGG - Intronic
1142509866 17:386341-386363 TGGTGACCTCGCCGCGGGGCGGG + Intergenic
1142518916 17:491604-491626 CGTGGCCCCCACCGGGCGGCCGG - Intergenic
1142688532 17:1591506-1591528 CGGGACCCCGGCTGGGGGGCGGG + Intronic
1142757578 17:2025034-2025056 CGGTGCCCTCGGCGCGGGGCTGG - Exonic
1142799776 17:2337818-2337840 GGGTGCCCGCGCCGGGGGGTGGG - Intronic
1142898185 17:2995687-2995709 AGGGGCCCTGGGCGGGAGGCGGG + Intronic
1143635582 17:8162412-8162434 CGGAGCCCTGGCTGCGGGGCCGG - Intronic
1144128117 17:12221141-12221163 AGGAGCCCACGGCGGGGGGCGGG - Intergenic
1144692945 17:17280871-17280893 AGGGGCCCAGGCCGGGGGGAGGG + Intronic
1146654447 17:34626795-34626817 GGGGGCTCCCGCCGGGGGGCCGG + Intronic
1146846057 17:36182928-36182950 CGGGGCCGGGGCCGGTGGGCAGG - Intronic
1146846139 17:36183174-36183196 CGGGGCCCTCACGGAGCGGCCGG - Intronic
1147164516 17:38586278-38586300 CAGGGCCCACGCTGGGGGGATGG - Intronic
1147598980 17:41734267-41734289 CGGGCCACTGGCCGGGGGACTGG - Exonic
1147896544 17:43755305-43755327 CGGGGCGCCCGCCGGTGGGGAGG + Exonic
1148798123 17:50207144-50207166 AGGGGGCGTGGCCGGGGGGCGGG + Intergenic
1149614799 17:57988415-57988437 CAGGGCCCCCGCGGGGGGGCTGG + Intergenic
1149849488 17:60026599-60026621 CGGGGCCCTCCCGGAGCGGCCGG - Intergenic
1149860680 17:60119925-60119947 CGGGGCCCTCCCGGAGCGGCCGG + Intergenic
1150213557 17:63454728-63454750 GGGGGGCCACGCAGGGGGGCAGG + Intergenic
1151491006 17:74432372-74432394 CGGGGCCCGGGCCGGGACGCAGG - Intronic
1152739371 17:82012316-82012338 CGGGGCCCTCCAGGGAGGGCAGG + Intronic
1153854957 18:9136683-9136705 AGGGGCGGGCGCCGGGGGGCGGG + Intronic
1153934966 18:9913609-9913631 CGGGGCCTTCGCCGAGGGCCTGG - Intergenic
1155007364 18:21741112-21741134 CCGGCCCCTCGCTCGGGGGCGGG - Intronic
1155199350 18:23503588-23503610 CGGGGCCCCCGCCGCGGGCGCGG + Exonic
1157464191 18:47930517-47930539 CCGGGCCCGGGCCTGGGGGCGGG - Exonic
1160163330 18:76491555-76491577 GGGGGCGGGCGCCGGGGGGCGGG + Intronic
1160566143 18:79787935-79787957 CGGGGTCCGCGCCGCGGGGCGGG + Intergenic
1160592357 18:79951589-79951611 CGGGGCGCTGGGCGCGGGGCTGG - Exonic
1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG + Intergenic
1160656880 19:277349-277371 CATGGCCCTCGCCTGGGGTCAGG - Intergenic
1160719296 19:590340-590362 CGGGGCCCGCGCCGGGGCCGGGG + Exonic
1160726144 19:618664-618686 CTGGGGCCTGGCCGGGGGTCTGG - Intronic
1160810413 19:1010700-1010722 CGGGGCCCAGGGCGGGGGGCTGG + Exonic
1160812972 19:1020914-1020936 CGAGGCCCGCGCGCGGGGGCCGG + Exonic
1160824908 19:1074946-1074968 CAGGGCCCTCGCTATGGGGCTGG - Intronic
1160927812 19:1555520-1555542 CGGGGCCATCTGCGGGGGCCAGG - Exonic
1160930483 19:1567695-1567717 CGGGGGCCACGGCGGGGGCCAGG + Exonic
1161009786 19:1954648-1954670 CGGGGCCCTCCCCAGGGAACTGG + Intronic
1161251840 19:3285001-3285023 CGGGGCCCTAGGCGGGGGCGGGG - Intronic
1161266408 19:3366680-3366702 CGGGGGCGCCGGCGGGGGGCCGG - Intronic
1161411561 19:4121034-4121056 CGGGGCCCTTGGCTGGGGTCCGG - Intronic
1161853358 19:6750365-6750387 CGGGGCGCTAGCGGGGGGGTCGG - Exonic
1162019761 19:7863076-7863098 CGGGGCCGGGGTCGGGGGGCGGG + Intronic
1162140175 19:8580728-8580750 CAGGGCCCTGGCTGGGGGGATGG - Exonic
1162144546 19:8605662-8605684 CTGGGCCCTCGCCCTGGGGCTGG - Exonic
1162257032 19:9498819-9498841 CGGGGCCCATGCCCGGGGGCGGG + Intergenic
1162312166 19:9913970-9913992 AGAGGTCCTCGGCGGGGGGCGGG - Intronic
1163270835 19:16252535-16252557 CGGGGCCCTGTACTGGGGGCTGG + Intergenic
1163535510 19:17874219-17874241 CGGGGCCCTGAGCGGAGGGCGGG - Intronic
1163583853 19:18153662-18153684 CGGTCCCCTAGCCGGGTGGCCGG + Intronic
1163851126 19:19664083-19664105 CGGGGCCCGGTGCGGGGGGCGGG + Intergenic
1163921780 19:20296553-20296575 CGGGGCCCCTGCCGGGCGGAGGG - Intergenic
1165057516 19:33187414-33187436 CGGGGCAGTGGCGGGGGGGCAGG - Intronic
1165349737 19:35269189-35269211 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
1165421403 19:35723800-35723822 CCAGGCCCACGCCGGGGGGCGGG + Exonic
1165742358 19:38211583-38211605 TGGGGCGCCCGGCGGGGGGCCGG + Intronic
1165996261 19:39846191-39846213 TGGGGCCTTGGCCTGGGGGCAGG - Intronic
1166205106 19:41264478-41264500 CGGGGGCCACCCCGGGGGCCCGG + Exonic
1166224007 19:41383783-41383805 GGGGGTCCTCGCCGTCGGGCTGG + Exonic
1166762551 19:45234269-45234291 CGGGGCCCTGGCCGAGTGGCTGG - Intronic
1166762590 19:45234401-45234423 CGGGGGCCTGGCCGGGCAGCTGG - Intronic
1166784467 19:45359371-45359393 CTGGGCCCTTGCCCTGGGGCTGG - Intronic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167410030 19:49339065-49339087 CGGGGCCCTCTGAAGGGGGCGGG + Intronic
1167418214 19:49388334-49388356 TGGGAACCTCGCCGCGGGGCAGG - Intronic
1167471807 19:49679780-49679802 CTGGGCTCTGGCCGGGGGGTGGG - Intronic
1167662651 19:50804973-50804995 CGGGGCCCAAGCCGAAGGGCCGG + Intergenic
1168072392 19:53960317-53960339 CGGCGCCCAGGCCGGGAGGCTGG + Intergenic
1168284214 19:55322398-55322420 CTGGGCCCTCCCCAAGGGGCTGG - Intronic
1168339122 19:55613803-55613825 CGGGGGCTGCGGCGGGGGGCCGG - Exonic
1168719039 19:58544814-58544836 CGGAGCCCTCGCCCGGGCCCGGG - Exonic
925609339 2:5691407-5691429 CGGGCCCCTCGCAGGGACGCCGG + Intergenic
927472116 2:23384922-23384944 CGGGGGCCACCGCGGGGGGCGGG + Intergenic
927809474 2:26173437-26173459 CGGGGCCCACGCCGGGGAGCTGG - Intronic
927962637 2:27250406-27250428 CGGGGCCCTGACCGGGCGGGAGG + Intergenic
928511997 2:32010736-32010758 CGGGGCCGGCGGCGGGCGGCCGG - Intronic
930011425 2:46941040-46941062 CGGGGGCGGCGGCGGGGGGCGGG + Intronic
931762888 2:65432384-65432406 CGGGGTCGCCCCCGGGGGGCCGG + Intronic
931791340 2:65666648-65666670 TGGGGCCCTGGCCGTGGGGATGG + Intergenic
933751063 2:85602423-85602445 CGGCGCCCTGGGCGAGGGGCGGG + Intronic
935371827 2:102355795-102355817 CGGGACCCGCGCCGCGCGGCTGG + Intronic
935634833 2:105242346-105242368 CGGGGCCCTCGCTCACGGGCTGG + Exonic
937082126 2:119147637-119147659 CGGGGCCCTCGCCTGTGAGATGG + Intergenic
939547442 2:143570908-143570930 CTGGCCCCTGGCTGGGGGGCTGG - Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942971432 2:181962277-181962299 CGGGGACCTGGCCGCGGGGATGG - Intronic
943185295 2:184598868-184598890 CGGGGCCGGCGACGGTGGGCTGG - Exonic
944221857 2:197310937-197310959 CGGGGGCAGCGCCGGGGGCCGGG - Intronic
946341747 2:219073921-219073943 AGGGGCCCAAGCCAGGGGGCAGG + Intergenic
946433443 2:219637673-219637695 GGGGGCCCTCGGTGGGGGGCAGG - Exonic
947523363 2:230864859-230864881 CGGGGCCCTCCCGCGGGGACGGG + Intronic
947800881 2:232928034-232928056 CGGGGGCCACGCCGGGGCCCTGG + Intronic
948205141 2:236159537-236159559 CCGGGCCCTGGCTGGGGGCCCGG + Intergenic
948367855 2:237470058-237470080 AGAGGCCCTGGCCAGGGGGCTGG + Intergenic
948534951 2:238638819-238638841 CGTGGCCCTCCCCTGGGTGCAGG + Intergenic
1169141830 20:3230921-3230943 CGGGGCCATCGGTGAGGGGCTGG - Exonic
1169214797 20:3786667-3786689 CGGGCGCGTCGCCGGGCGGCGGG + Exonic
1170969764 20:21105561-21105583 CAGGGCCCTCGCCGGGTGAGGGG - Intergenic
1172118529 20:32584905-32584927 CGGCGCCCTCGGGGGCGGGCCGG + Intronic
1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG + Intronic
1174349526 20:49956922-49956944 CGGGGACCTGGCCGGGGGGATGG + Intergenic
1174814848 20:53677853-53677875 CGCGGCCCCCGCCTGGTGGCCGG + Intergenic
1175562076 20:59939433-59939455 CGGCGGCCTCGACGGGCGGCGGG + Exonic
1175877708 20:62238388-62238410 CGAGGCTCGCGCCGGGGGGTGGG - Intronic
1175912462 20:62411324-62411346 TGTGGCCCTAGCCCGGGGGCAGG - Intronic
1176194585 20:63831335-63831357 CCGGGCGCGCGCCGGGGGGCGGG - Intergenic
1176270231 20:64232426-64232448 AGGGACCCTCGCCTGGGGCCTGG + Intronic
1179787316 21:43737319-43737341 CGGGGGCCTGGCCGGGGGAAGGG - Intronic
1180843628 22:18970407-18970429 CGGGGCCCTCACCTGGGCGCAGG - Intergenic
1181031078 22:20149130-20149152 CAGGGCCCTGGGTGGGGGGCTGG + Intronic
1181042093 22:20197046-20197068 AGGGCCCCTCGCGGGGGGCCTGG - Intergenic
1181051899 22:20241880-20241902 TCGGGCCCTCGCCGGAGGCCAGG - Exonic
1181163926 22:20973577-20973599 GGGGGCCATAGCCGGGGGTCGGG + Intronic
1181478202 22:23181278-23181300 CGGGCTCCTCGGCGGGCGGCGGG - Exonic
1181514358 22:23402653-23402675 CGGGGCGCTCACCTGGGCGCCGG + Intergenic
1182547575 22:31084928-31084950 CGGGCTCCTCCCCGCGGGGCCGG + Intronic
1182576479 22:31276580-31276602 CGCCGCCCTCGCCGCGGAGCCGG + Intronic
1183546294 22:38456053-38456075 CGGGGCCCGCGGCGCGGAGCAGG + Intergenic
1183665586 22:39244145-39244167 CGGCTCCGTCGCTGGGGGGCAGG + Exonic
1183750269 22:39716096-39716118 ACGGGCCCTGGCGGGGGGGCAGG - Intergenic
1184236852 22:43187324-43187346 CGGGGCGGTGGGCGGGGGGCTGG - Intergenic
1184386921 22:44181797-44181819 CGGGGACCAGGCCGGGAGGCAGG - Exonic
949877089 3:8633623-8633645 GGGGGCCTTGGCCGGGGGGCTGG - Intronic
949987775 3:9553554-9553576 AGGGGCTGTCCCCGGGGGGCTGG + Intronic
950021878 3:9793134-9793156 GGGGTCCCTGGCCGGGGGCCCGG - Exonic
950109619 3:10410621-10410643 CGTTGCCCTCGCCGGGCGGGTGG + Exonic
950498173 3:13346899-13346921 TGGGGCCCTGGCCTGGGTGCTGG + Intronic
953246804 3:41200049-41200071 CCGGGCCCTGGGTGGGGGGCGGG + Intronic
953758134 3:45665477-45665499 CGTGGCCCTCGGCGAGAGGCAGG - Intronic
954632909 3:52056594-52056616 CGAGGCGTTCTCCGGGGGGCGGG + Intergenic
954783161 3:53074970-53074992 CGGGGCCCTCACTCTGGGGCTGG - Intronic
956892335 3:73624842-73624864 CGGGGTCGCCGCCGGGCGGCCGG + Exonic
962708570 3:138067531-138067553 CTGAGCCCTGGCCAGGGGGCTGG + Exonic
964771202 3:160225730-160225752 TGGCGCCCTCGCGGGGCGGCGGG + Exonic
965074904 3:163963879-163963901 CGGGGCCCTGGCCCTGGTGCAGG - Intergenic
965092278 3:164179524-164179546 AGGAGCCCACGGCGGGGGGCAGG - Intergenic
967493648 3:190120422-190120444 CGGGGCCCTCGCCGGGGGGCGGG + Exonic
968092808 3:195909096-195909118 CGAGGCCCGGGCCGGGGTGCAGG - Intronic
968453806 4:687285-687307 CGGGGCTCACTCCGGGAGGCAGG + Intronic
968492630 4:898373-898395 AGGGGCCCTGGCGGGTGGGCCGG + Intronic
968512282 4:1001008-1001030 TGGGGCCCTGGCCGGGGCGGGGG + Intronic
968616718 4:1580740-1580762 CGGGGACCTGGACGGGAGGCAGG - Intergenic
968655904 4:1778342-1778364 CAGGGCCGTCGCCAGGGGGCCGG + Intergenic
969611502 4:8229841-8229863 CGAGGCCCTCCCCGGGGTGCTGG + Intronic
970628047 4:17911853-17911875 CGGGGACCTGGCCGTGGGGATGG + Intronic
971257962 4:25031003-25031025 CGGGGCCCGCCCCGCGGGGGAGG + Intergenic
973338845 4:48984372-48984394 CGGGCCTGTCGCAGGGGGGCTGG + Intergenic
978886567 4:113772544-113772566 CGGGCACCTCCCCGCGGGGCAGG + Intergenic
979311824 4:119212544-119212566 CGGAGCCCGCTCCGAGGGGCGGG + Intronic
982097430 4:151935600-151935622 GGGGGCCCTTGCAGGGAGGCAGG + Intergenic
982722035 4:158869214-158869236 CGGGGCCCTGGCCTCGTGGCTGG + Exonic
984668004 4:182448841-182448863 CGGGGCGCTGGGCGCGGGGCTGG + Intronic
984778586 4:183504903-183504925 CGGGGCCGGCGCCGGGGTCCCGG - Intergenic
985122968 4:186662011-186662033 TGGGGGGCTGGCCGGGGGGCGGG - Intronic
985537435 5:473147-473169 CGGGGCCTGCGCCGGGGGCGGGG - Intergenic
985817839 5:2139716-2139738 CTGGGCCCTCCCATGGGGGCCGG + Intergenic
985894941 5:2743377-2743399 CGGGGCGCTTGCCCGGCGGCCGG - Intergenic
986721612 5:10564436-10564458 CGGGGCGCGGGCCGGGGGCCGGG - Intronic
996451997 5:123636289-123636311 CGGGGGCCTGGCCGCGGGGATGG + Intergenic
998156282 5:139788700-139788722 CGGGGCCCTGGGCCGGCGGCCGG + Intergenic
999230616 5:150059752-150059774 CGGGGTCCTGGCCGGGGCTCAGG + Exonic
1000014580 5:157266130-157266152 AGGGCCCCGCGCCGGGGCGCAGG - Exonic
1002559864 5:180073733-180073755 CGGGGTCCTCGCCCTGGGCCTGG + Intergenic
1002926558 6:1609004-1609026 TGGGACCCTCGCGGGCGGGCAGG + Intergenic
1002926592 6:1609091-1609113 CGCCCCCCTCCCCGGGGGGCCGG - Intergenic
1004615087 6:17281552-17281574 CGGAGCCCGAGCCGCGGGGCGGG + Exonic
1004690232 6:17987301-17987323 CGCGGCCGGGGCCGGGGGGCCGG - Intronic
1006735932 6:36272469-36272491 CGGGGCCATGGCCTGGGGGTTGG + Intronic
1007633686 6:43285884-43285906 CTGGACCCTCGCGGGGAGGCTGG - Exonic
1007701771 6:43770113-43770135 CCCGGCCCGCCCCGGGGGGCGGG - Intergenic
1007701926 6:43770807-43770829 CGGAGCCCGCGCCCGGAGGCGGG + Exonic
1008649024 6:53544803-53544825 AGGGGCCGCCGCCGGGGAGCCGG - Exonic
1010703244 6:79077577-79077599 CGGGGTCCCCGCCGGGGCGCGGG - Intronic
1012401411 6:98845241-98845263 CGGGGCCCGCGGGGCGGGGCGGG - Intergenic
1013012753 6:106134847-106134869 CTGGGCCCTCCACGGGGGCCTGG - Intergenic
1014925607 6:127266939-127266961 CGAGGCCCTCTCGGGGGAGCAGG + Intronic
1015965737 6:138693573-138693595 CGGGGCGTTCCCCGCGGGGCGGG - Intergenic
1016329954 6:142945375-142945397 GGGGGCACACGCCGGGGAGCGGG + Intergenic
1017324562 6:153130903-153130925 CGGGGGCCGCGCCGCGGGTCCGG - Intronic
1017793861 6:157823779-157823801 CGGGGGCCTCCCCGGGCTGCGGG - Intronic
1018919785 6:168163610-168163632 CAGTGCCCTCGGCGGGAGGCAGG + Intergenic
1019134365 6:169899092-169899114 CGGGGCGCTCAGCAGGGGGCGGG - Intergenic
1019608408 7:1922173-1922195 CAGGGCGCTCGCCGCTGGGCTGG - Intronic
1019708859 7:2509374-2509396 GGGAGCCCTGGCCTGGGGGCTGG - Intergenic
1019709519 7:2511840-2511862 GGGAGCCCACGGCGGGGGGCTGG - Intergenic
1020105244 7:5419729-5419751 AGGGGCGCGCGCCCGGGGGCCGG - Intronic
1021992501 7:26152129-26152151 CGGGGCCCGCGCCCGTGGGAGGG - Intergenic
1027267985 7:76504476-76504498 CGGGGCCCTGACCAGGCGGCAGG + Intronic
1027319796 7:77004338-77004360 CGGGGCCCTGACCAGGCGGCAGG + Intergenic
1029708491 7:102287370-102287392 CGGGGCCCTAGCAGGGGGCGGGG - Intronic
1029896561 7:103989874-103989896 AGGGGCGCCCGCCGGGGAGCGGG + Intergenic
1032119262 7:129144820-129144842 AGGCGCCCGAGCCGGGGGGCCGG - Intergenic
1032197053 7:129795398-129795420 CGGGGTCCTGGTCGGGGGGATGG + Intergenic
1033132360 7:138755585-138755607 CAGGGCCCTTGCTGGGAGGCTGG - Intronic
1033299714 7:140176028-140176050 CCGGGCCCCCGGCGGGCGGCAGG - Intronic
1034129037 7:148698952-148698974 CGGGGCTTTCGCCGGGGCCCAGG + Exonic
1034440499 7:151083386-151083408 CGGGGCCCTGGGCGGCGGGGTGG + Intronic
1034508982 7:151519401-151519423 CCGGGGCCTCGCCTGGGAGCCGG - Intronic
1036390253 8:8318761-8318783 CGGGGCCCTTCCGGGGAGGCGGG + Exonic
1037827017 8:22165565-22165587 CTGGCCCGTCGCCGGGGGGCCGG - Intronic
1040079917 8:43275514-43275536 AGGGGCCCTCGGCAGGGGCCTGG + Intergenic
1045118850 8:99013443-99013465 CGAGGGCCTCGCGGGGTGGCTGG + Intronic
1045432048 8:102123810-102123832 CGGGGCCGGGGCCGGGGGCCGGG - Intronic
1049109882 8:140635853-140635875 CGGAGACCTCGCCGGGCGGTGGG + Intergenic
1049166481 8:141128927-141128949 CGGGGTCACCGCCGGGGGACCGG - Intronic
1049479918 8:142817773-142817795 CGGGGGAAGCGCCGGGGGGCTGG - Intergenic
1049850384 8:144827345-144827367 CGGGGCTGGCGCCTGGGGGCGGG - Intergenic
1050094234 9:2047274-2047296 CGGTGCCCGCGCCCGGCGGCCGG + Exonic
1051279045 9:15423033-15423055 CGGGGCCGTCTGCGCGGGGCCGG + Exonic
1052613056 9:30800551-30800573 CGGGGACCTGGCCGCGGGGATGG - Intergenic
1052613768 9:30811895-30811917 CGGGTCCCTGGCCTGGGGTCTGG - Intergenic
1055708909 9:79037497-79037519 CGGGGGCCTGGCCGCGGGGATGG - Intergenic
1057739483 9:97699100-97699122 CGGGGGCCTGGCCGCGGGGATGG + Intergenic
1059107640 9:111525290-111525312 CGGGGCCGTGGCCGGGTCGCCGG + Intronic
1059119822 9:111631656-111631678 CGGGGCCCTCGTCTCCGGGCTGG - Exonic
1060478132 9:124000181-124000203 CCGGGCCAGGGCCGGGGGGCGGG - Intergenic
1060770266 9:126327084-126327106 CGGGCCCCCGGCCGAGGGGCGGG + Intronic
1061095936 9:128456742-128456764 CAGGGCCCTCGCCCGGCGGGGGG + Intronic
1061248417 9:129413376-129413398 CGGGGGCCGGGGCGGGGGGCAGG - Intergenic
1061293715 9:129666169-129666191 CGGGGCCGGGGCCGGGGCGCGGG + Intronic
1061299760 9:129697766-129697788 GGGGGCGCTAGCAGGGGGGCAGG - Intronic
1061347938 9:130042448-130042470 CGGGGCGAGCGCCGGGGGTCGGG - Intronic
1061415451 9:130444846-130444868 CGGGGGCCGGGCCCGGGGGCGGG + Intergenic
1061550932 9:131334287-131334309 AGGGGCCCTGGCCTGGAGGCTGG - Intergenic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061944576 9:133901614-133901636 CCGGGCCCTTGCTGGAGGGCAGG - Intronic
1061956917 9:133968561-133968583 TGGGGCCATCCCCGGGGGCCTGG + Intronic
1062162632 9:135088387-135088409 TGGGCCCCTCGCCGCGGGGCCGG + Intronic
1062230510 9:135479563-135479585 CGGGGGCGTCCCCGGGGCGCGGG + Intronic
1062397434 9:136358139-136358161 GGTGGACCTCGCCGGGGGCCCGG + Exonic
1062526024 9:136978452-136978474 CGGGGCCATCTCCGGGGGAGGGG + Intronic
1062534369 9:137015060-137015082 CGGGGCCCGACCTGGGGGGCTGG + Exonic
1062584785 9:137244357-137244379 TGGGGGCCTGGCCGGAGGGCCGG + Intronic
1062597293 9:137305043-137305065 CTGGGCCCTCCCAGGCGGGCCGG - Intergenic
1185894085 X:3843235-3843257 CAGGGCCCTCCCCAGGAGGCGGG + Intronic
1185899203 X:3881659-3881681 CAGGGCCCTCCCCAGGAGGCGGG + Intergenic
1185904320 X:3920088-3920110 CAGGGCCCTCCCCAGGAGGCGGG + Intergenic
1187067414 X:15854597-15854619 CGGGGCGCGCGCGGGGTGGCGGG + Intronic
1187900797 X:24025434-24025456 CGGGGCCCGCCCAGGGAGGCGGG + Intronic
1199772678 X:150984263-150984285 TGCGCCCCGCGCCGGGGGGCGGG + Intronic
1200173734 X:154097554-154097576 GGGGACCCTTGCCGGGGGGCGGG - Intronic