ID: 967499702

View in Genome Browser
Species Human (GRCh38)
Location 3:190183682-190183704
Sequence CTTCATGTTGAAATGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967499702_967499707 14 Left 967499702 3:190183682-190183704 CCTGCCTTCATTTCAACATGAAG No data
Right 967499707 3:190183719-190183741 TGGATTTATCTGGCCTTCACAGG No data
967499702_967499705 4 Left 967499702 3:190183682-190183704 CCTGCCTTCATTTCAACATGAAG No data
Right 967499705 3:190183709-190183731 AGCCAACAAATGGATTTATCTGG No data
967499702_967499704 -6 Left 967499702 3:190183682-190183704 CCTGCCTTCATTTCAACATGAAG No data
Right 967499704 3:190183699-190183721 ATGAAGAAAGAGCCAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967499702 Original CRISPR CTTCATGTTGAAATGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr