ID: 967500344

View in Genome Browser
Species Human (GRCh38)
Location 3:190190281-190190303
Sequence CTATATTAGAAATGAAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967500344_967500348 20 Left 967500344 3:190190281-190190303 CCCAGTTTTCATTTCTAATATAG No data
Right 967500348 3:190190324-190190346 CTACATAAACAGAAGCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967500344 Original CRISPR CTATATTAGAAATGAAAACT GGG (reversed) Intergenic
No off target data available for this crispr