ID: 967507005

View in Genome Browser
Species Human (GRCh38)
Location 3:190263819-190263841
Sequence GCTAAACTATGAGGACGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967507000_967507005 10 Left 967507000 3:190263786-190263808 CCAAATACCATATGTTCTCACTT 0: 166
1: 1875
2: 4403
3: 11870
4: 18040
Right 967507005 3:190263819-190263841 GCTAAACTATGAGGACGTAAAGG No data
967507001_967507005 3 Left 967507001 3:190263793-190263815 CCATATGTTCTCACTTAAAAGTG No data
Right 967507005 3:190263819-190263841 GCTAAACTATGAGGACGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967507005 Original CRISPR GCTAAACTATGAGGACGTAA AGG Intergenic
No off target data available for this crispr