ID: 967507817

View in Genome Browser
Species Human (GRCh38)
Location 3:190272936-190272958
Sequence GGGCAGGTTGCTGCAAATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967507808_967507817 15 Left 967507808 3:190272898-190272920 CCTGGTCTGTTTACTGTACATAA No data
Right 967507817 3:190272936-190272958 GGGCAGGTTGCTGCAAATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967507817 Original CRISPR GGGCAGGTTGCTGCAAATCG TGG Intergenic
No off target data available for this crispr