ID: 967507821

View in Genome Browser
Species Human (GRCh38)
Location 3:190272989-190273011
Sequence CTGAATGTACAAATGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967507821_967507823 24 Left 967507821 3:190272989-190273011 CCATTGTTCATTTGTACATTCAG No data
Right 967507823 3:190273036-190273058 ATCTGGCTTTCCTGAACTTCAGG No data
967507821_967507822 7 Left 967507821 3:190272989-190273011 CCATTGTTCATTTGTACATTCAG No data
Right 967507822 3:190273019-190273041 CTTTTGTGATTTTTGTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967507821 Original CRISPR CTGAATGTACAAATGAACAA TGG (reversed) Intergenic
No off target data available for this crispr