ID: 967508274

View in Genome Browser
Species Human (GRCh38)
Location 3:190279177-190279199
Sequence CCTAACATGCCCAGACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967508270_967508274 2 Left 967508270 3:190279152-190279174 CCAGAGTTAGCAGCAGCTTGAAG No data
Right 967508274 3:190279177-190279199 CCTAACATGCCCAGACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967508274 Original CRISPR CCTAACATGCCCAGACTGGA AGG Intergenic
No off target data available for this crispr