ID: 967510060

View in Genome Browser
Species Human (GRCh38)
Location 3:190300766-190300788
Sequence GTTTAAGTGTTCTGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967510060_967510065 30 Left 967510060 3:190300766-190300788 CCTCCTTCCCAGAACACTTAAAC No data
Right 967510065 3:190300819-190300841 ATAAAGATGCAATTATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967510060 Original CRISPR GTTTAAGTGTTCTGGGAAGG AGG (reversed) Intergenic