ID: 967510408

View in Genome Browser
Species Human (GRCh38)
Location 3:190304596-190304618
Sequence GCAGCTTCTAGGGTTATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967510408_967510414 28 Left 967510408 3:190304596-190304618 CCCCACATAACCCTAGAAGCTGC 0: 1
1: 0
2: 1
3: 7
4: 127
Right 967510414 3:190304647-190304669 CAGCTAAATGAAGAGATTTTAGG 0: 1
1: 0
2: 2
3: 28
4: 414
967510408_967510415 29 Left 967510408 3:190304596-190304618 CCCCACATAACCCTAGAAGCTGC 0: 1
1: 0
2: 1
3: 7
4: 127
Right 967510415 3:190304648-190304670 AGCTAAATGAAGAGATTTTAGGG 0: 1
1: 0
2: 3
3: 73
4: 794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967510408 Original CRISPR GCAGCTTCTAGGGTTATGTG GGG (reversed) Intergenic
900922325 1:5681076-5681098 GCAGCGTCTGGGGTGAGGTGAGG + Intergenic
905207492 1:36351195-36351217 TCCTCTTCTGGGGTTATGTGAGG - Intronic
914241348 1:145855048-145855070 GCACTGTCTAGGGTTATGTGTGG + Intronic
915752691 1:158226988-158227010 GCAGGTCCTGGTGTTATGTGGGG + Intergenic
916019676 1:160780724-160780746 CCATCTTCTAGGATTTTGTGAGG + Intergenic
916917068 1:169418691-169418713 CCAGTCTCTAGGGTTTTGTGGGG + Intronic
921498399 1:215869120-215869142 GCACCTTATAGAGTTTTGTGAGG - Intronic
1063216735 10:3932162-3932184 GCAGCTTCTGGGCTCATGTAGGG + Intergenic
1064142323 10:12800893-12800915 GCAGCTTAGAAGGTTATGTCAGG + Intronic
1069557651 10:69408298-69408320 GCACCTTCTATAGTTCTGTGGGG + Intronic
1070361525 10:75694675-75694697 GCTGCTTCTATTGTTATTTGAGG - Intronic
1072318487 10:94225986-94226008 GGAGCTTGTAGGGCCATGTGAGG + Intronic
1073129877 10:101181192-101181214 GCAGCTTCTACGGCTAGATGTGG + Intergenic
1079787397 11:24690753-24690775 CCAGCTTCTGGGGTTATGATTGG + Intronic
1084716449 11:70877322-70877344 GAAGCCTCTTGGCTTATGTGAGG - Intronic
1085103488 11:73821762-73821784 CCAGCTTCTAGGGCAATGCGTGG + Intronic
1090259455 11:125308244-125308266 GTAGCTCCTTGGCTTATGTGTGG + Intronic
1090612072 11:128480255-128480277 GCACCTTCAAGGACTATGTGCGG - Exonic
1091261125 11:134235074-134235096 GCAGGTTCTAGGGTACAGTGGGG - Intronic
1093165751 12:15803187-15803209 GCAGCTTCTAGGGCTAACTCAGG + Intronic
1095833290 12:46610260-46610282 GCAGCTTATAGGATTATGGAAGG - Intergenic
1101575914 12:105996098-105996120 TCAGCTGCTGGGGTTGTGTGGGG - Intergenic
1105756091 13:23466025-23466047 CCAGCTTTTAGGGTTCCGTGAGG - Intergenic
1114195990 14:20476628-20476650 GCAGCTACTTGGGTCTTGTGTGG - Exonic
1114960481 14:27881846-27881868 GCTGCTTCTAGGGTTGGGGGAGG + Intergenic
1119561131 14:75590771-75590793 GCATCTGCTAGGGTTCTGGGAGG - Intronic
1121206620 14:92174194-92174216 GCACTTCCTAGGGTCATGTGAGG + Intergenic
1124012773 15:25852084-25852106 GCAGCTTCTGGTGTGCTGTGAGG - Intronic
1125432485 15:39609520-39609542 GCAGCTGCTGGGGTTGGGTGGGG - Intronic
1126999120 15:54481628-54481650 GCAGCTGCTTGGGTTTTGGGGGG + Intronic
1129343309 15:74900412-74900434 GCAGCTTCTAGGGGTGAGGGTGG - Exonic
1132456465 16:26402-26424 AGAGCTTCTGGGGTTTTGTGGGG - Intergenic
1134671494 16:16059044-16059066 GCAGCACCTAGGGATATGTTAGG - Intronic
1134910080 16:18017853-18017875 GCAGCTGCTGGAGTTATGTAGGG + Intergenic
1136254479 16:29029119-29029141 GCAGCTCCTGGGCTTTTGTGAGG + Intergenic
1136511700 16:30741843-30741865 GCAGCTACTAGCATTATCTGTGG + Intronic
1139787275 16:69404021-69404043 TCACCTGCTAGGGTTCTGTGTGG + Intronic
1140138075 16:72225755-72225777 AGAGCTTCTAGGATTTTGTGAGG - Intergenic
1141327103 16:83071289-83071311 ACACCTTGCAGGGTTATGTGAGG - Intronic
1141697196 16:85625709-85625731 GCAGCTTCAAGGGTGTCGTGGGG + Intronic
1146815001 17:35935624-35935646 GCTGCTTTTTGTGTTATGTGGGG - Intronic
1149681157 17:58508246-58508268 GCAGCTTCTGGGGGTAACTGGGG + Exonic
1152879511 17:82807156-82807178 GCATCCTCTAGGCTTCTGTGTGG + Intronic
1154311128 18:13266763-13266785 GCAGCTCCAAGGGTAGTGTGGGG - Intronic
1155532923 18:26785846-26785868 GCAACTTCTAAGGCTAAGTGAGG - Intergenic
1156950008 18:42884402-42884424 GCTTATTTTAGGGTTATGTGTGG - Intronic
1158641341 18:59206651-59206673 GCAGATACTCGGGGTATGTGAGG - Intergenic
1166590899 19:43997679-43997701 GCTGCTTTTTGTGTTATGTGGGG - Exonic
925273032 2:2628349-2628371 ACATCTTCTAAGGTTATTTGAGG - Intergenic
925456536 2:4021239-4021261 GCTGATTCTAGGGCTCTGTGTGG - Intergenic
930465694 2:51746362-51746384 GCAACTTCCAGGGTTAGGAGAGG - Intergenic
931235249 2:60407225-60407247 GAAGCTTCTCGGGTTATGAAGGG - Intergenic
932074287 2:68648458-68648480 GGAGCTTCTATGGTTGAGTGGGG + Intronic
933340976 2:81025713-81025735 GCAGCTTCTATGATTATGGAAGG - Intergenic
936667244 2:114610646-114610668 TCAGCCTCTTGGGTTATGTCTGG - Intronic
936909636 2:117576870-117576892 TCAGCATCTGGGGTTAGGTGGGG - Intergenic
937676066 2:124592026-124592048 TCAGCTTGTAGTGTTACGTGTGG + Intronic
938377234 2:130815849-130815871 GGAGCTTCTAGGCTGGTGTGGGG + Intergenic
942504873 2:176631057-176631079 GCAACTGCTAGGGCTTTGTGGGG + Intergenic
1168954809 20:1827483-1827505 GCACCTGGTAAGGTTATGTGTGG - Intergenic
1170290296 20:14761802-14761824 GGAGCTCCTAGGTTTATGTGCGG - Intronic
1174920685 20:54698625-54698647 TCAGGTTTTATGGTTATGTGTGG + Intergenic
1177822069 21:26041962-26041984 GCAGCTTCCAGGACTGTGTGAGG - Intronic
1178072951 21:28989515-28989537 CTAGCTTCTAGAGTTATTTGTGG + Intronic
1181308235 22:21929046-21929068 GCAGCTTCCAGGAGTACGTGGGG - Intronic
1181617904 22:24067377-24067399 GCAGGTTCTAGGGTTCTGCGTGG + Intronic
1184142534 22:42586318-42586340 GTATGTTCTAGGGTTTTGTGGGG + Intronic
950188143 3:10958026-10958048 TCACCTCCTAGGCTTATGTGAGG + Intergenic
952039036 3:29239451-29239473 ACAGCTTCTGGAGTTATGTCAGG + Intergenic
953496022 3:43387609-43387631 GCAGCTTCTGGGGCTATGTGAGG + Intronic
954559030 3:51539854-51539876 GCAACTGGAAGGGTTATGTGGGG + Intergenic
954632597 3:52055505-52055527 GCCGCTTTTAGGGTTCTGGGAGG + Intronic
955338777 3:58108697-58108719 TTATCTTATAGGGTTATGTGAGG + Intronic
958803971 3:98787056-98787078 GCAGCTTTGGGGGTTTTGTGGGG + Intronic
961117351 3:124341973-124341995 GCAGCTTTTAGGGTGTTGGGGGG + Intronic
963777615 3:149455066-149455088 GCAGATTCCAGAGTTTTGTGTGG - Intergenic
963918591 3:150884218-150884240 GCAGCTTCCACTGTTATGTCAGG + Intronic
966885896 3:184378041-184378063 GCAGGGTGTGGGGTTATGTGAGG - Intronic
967510408 3:190304596-190304618 GCAGCTTCTAGGGTTATGTGGGG - Intergenic
967627534 3:191703368-191703390 GCAGCTGCTATGGCTATGGGTGG - Intergenic
968741845 4:2335107-2335129 GCAGCCTGTAGGGTCCTGTGGGG - Intronic
970064423 4:12075615-12075637 CCAGCATATAGGGTTATGTCTGG - Intergenic
972338034 4:38125947-38125969 GCAGATTCTAGGCTTATGAGAGG - Intronic
973121577 4:46526722-46526744 GCAGCTTTTAGGATTTTGTGGGG - Intergenic
973671617 4:53224611-53224633 GCATCTACTAAGGTTATTTGGGG - Intronic
977574616 4:98663029-98663051 ACAGCTGCTAGGGTTCTGAGAGG - Intergenic
982011714 4:151112109-151112131 GCTGCTTCTAGGCTTATTGGAGG + Intronic
982333444 4:154208155-154208177 GCAATTTCTAGGGTTATTTGAGG + Intergenic
984210328 4:176839592-176839614 GCATCTTCTTGAGTTCTGTGAGG - Intergenic
991931282 5:71755297-71755319 TCAGCTTCTAGGTTTACATGTGG + Intergenic
993094885 5:83470941-83470963 GCAGAATCTAGACTTATGTGGGG + Intergenic
998069007 5:139182097-139182119 GCAGCCTCTTGGGACATGTGTGG + Intronic
998369834 5:141653937-141653959 GCTGGTCCTAGGGTCATGTGAGG + Exonic
999153615 5:149442625-149442647 GCAGCTTCTAGTTTTGTGCGTGG - Intergenic
1002286561 5:178166266-178166288 TCAGCTTCGAGGGTGATGTTCGG + Intergenic
1003143101 6:3487948-3487970 GCAGCTTTCAGGGTCATTTGAGG + Intergenic
1003674942 6:8194409-8194431 CCAGCTTCTGGGGCTATTTGTGG - Intergenic
1004991773 6:21146512-21146534 ACAGCCTCTAGTGTTATTTGTGG + Intronic
1005521694 6:26607099-26607121 GCTGGTTTTAGGGTTGTGTGAGG + Intergenic
1007416800 6:41695829-41695851 GCAGCTTCTGGGGGTTTATGGGG + Intronic
1008594279 6:53025581-53025603 GCTGCTTAAAGGGATATGTGGGG - Intronic
1009308882 6:62125150-62125172 GCTGCTGCTAGGGTTTTGGGAGG - Intronic
1013541900 6:111118815-111118837 CCAGCTTCTCTGGTTGTGTGTGG - Intronic
1019841497 7:3450639-3450661 GAGGCTTTTAGGGTTTTGTGGGG + Intronic
1020150978 7:5681434-5681456 GCAGCTTCTAAGCTTCTGGGAGG + Intronic
1020677211 7:11196827-11196849 GCAGATACTCGGGGTATGTGAGG - Intergenic
1020993030 7:15225993-15226015 TCAGCTTCTATGATGATGTGTGG + Intronic
1021406401 7:20272221-20272243 GCAGCTTCCAGGTTTGTGTTAGG - Intergenic
1023674387 7:42615114-42615136 GCTGCTTCTAGGGGTTTATGGGG + Intergenic
1024350182 7:48355558-48355580 AGAGCTTGTAGGGGTATGTGTGG + Intronic
1029487436 7:100852293-100852315 GGAGGTTCTAGGGTTTTGAGAGG + Intronic
1030367538 7:108662381-108662403 ATAGCTTTTAAGGTTATGTGGGG + Intergenic
1036947702 8:13110152-13110174 GCAGCTTATAGGTTTTAGTGAGG - Intronic
1039986641 8:42453095-42453117 GCACCTTCTAAGGCAATGTGTGG - Intronic
1046730281 8:117718030-117718052 CCAGCTTCTAAGCTCATGTGAGG - Intergenic
1047335665 8:123933416-123933438 GCAGCTTATAGGCTAGTGTGAGG - Intronic
1049213373 8:141396796-141396818 GCAGCCCCTCGGGTTATGCGTGG - Intronic
1049537194 8:143187930-143187952 GCAGCTTTGAGGGTGGTGTGAGG + Intergenic
1050611599 9:7359664-7359686 CCAACTTCCAGGGTTTTGTGAGG - Intergenic
1051832299 9:21293342-21293364 TCAGCTTCTCTGGTTCTGTGGGG + Intergenic
1055286819 9:74737689-74737711 GCTGCTTCTAGGATTAAATGAGG + Intronic
1059469963 9:114497422-114497444 GCAGCTTTTAAGCATATGTGTGG + Intronic
1060447893 9:123708645-123708667 GCAGATGGTAGGGTTATGTGGGG + Intronic
1062550339 9:137083156-137083178 GCAGCTTCTAGTGCTCGGTGGGG - Exonic
1062670193 9:137704281-137704303 GCAGCCTGTAGGGGAATGTGTGG + Intronic
1186797206 X:13058496-13058518 GCCTCTCCTAGGGTTATATGAGG + Intergenic
1190219580 X:48502972-48502994 GCAGCTCCTATGGCGATGTGAGG - Intergenic
1191616427 X:63174739-63174761 GCAGCTTTTTGTGTTATATGGGG + Intergenic
1191619870 X:63204184-63204206 GCAGCTTTTTGTGTTATATGGGG - Intergenic
1192369190 X:70499361-70499383 TCAGATTCTAGGGCTATTTGGGG + Intronic
1193891166 X:87047437-87047459 GCACGTTCTTGGTTTATGTGTGG - Intergenic
1195350583 X:103992292-103992314 GCTGCTTTTGGGGTTCTGTGAGG - Intergenic
1195938311 X:110145769-110145791 GCTGCTTCTTGGCTTATGCGTGG + Intronic
1199026815 X:142949301-142949323 GCTGCTTCTAGGGGTGAGTGAGG - Intergenic
1200399897 X:156013321-156013343 AGAGCTTCTGGGGTTTTGTGGGG + Intergenic
1201307297 Y:12562001-12562023 GCAGCTTCTAGGGCTTTTTATGG + Intergenic