ID: 967511651

View in Genome Browser
Species Human (GRCh38)
Location 3:190320351-190320373
Sequence GCATTTTAGGTACCACGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967511651_967511656 15 Left 967511651 3:190320351-190320373 CCTTAACGTGGTACCTAAAATGC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 967511656 3:190320389-190320411 TAAATATATTTATCTTTCCATGG 0: 1
1: 0
2: 6
3: 101
4: 909

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967511651 Original CRISPR GCATTTTAGGTACCACGTTA AGG (reversed) Intronic
913229800 1:116732257-116732279 GCATTTTAGCTTCCACTTCAGGG + Intergenic
1069172457 10:65249913-65249935 GCATTTTTGCTACCACATTGGGG - Intergenic
1072307782 10:94123896-94123918 GCACTTTAAGAACCACATTATGG + Intronic
1097789334 12:63797624-63797646 GCCTTGTATGTACCACATTAAGG + Intronic
1097930404 12:65177774-65177796 TCATTTTAGATACCAAGTTCGGG - Intronic
1106306120 13:28511872-28511894 GCATTTTATGTCCCAGGATATGG + Intergenic
1109493444 13:63133931-63133953 GCCTTTTAGGTATCCAGTTAGGG + Intergenic
1110066222 13:71109619-71109641 TCATTTTAGGGTCCACTTTATGG - Intergenic
1115636305 14:35292903-35292925 GCATTTTAGTTGAGACGTTAAGG - Intronic
1121399434 14:93659607-93659629 ACATCTTAGATACCACATTAAGG - Intronic
1146367538 17:32240774-32240796 ACATTTTAGGATCCACGTTTTGG + Intronic
1146654730 17:34628586-34628608 CCCTTTTAGGTACCAAGTCACGG + Exonic
1148349458 17:46929361-46929383 GCACTTTAGGTCCCACGTTTTGG - Intronic
1148690525 17:49524518-49524540 GCATTATAGGACCCACTTTATGG + Intergenic
1149194347 17:54102146-54102168 GGATTTCAGGTACCACGTGCAGG - Intergenic
1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG + Intronic
1158456634 18:57614061-57614083 GCCTTTTAAGTACCATGTTCTGG - Intronic
1164053547 19:21603537-21603559 GCACTTCAGGAACCACGATAAGG + Intergenic
926947811 2:18207226-18207248 ACATTTTAGCTACAACATTAAGG - Intronic
927824474 2:26298610-26298632 GCACTTCAGGAACCACGGTAAGG + Intergenic
929168846 2:38910838-38910860 TAATTTAAGGTACCACTTTAAGG - Intronic
935919197 2:107992147-107992169 GCAGTTTATGTACCAGGTTATGG + Exonic
942489142 2:176472469-176472491 GTATTTTGGGGACCTCGTTAAGG + Intergenic
944977897 2:205078212-205078234 GAATTTTAGTTAGCAAGTTAAGG + Intronic
1177816076 21:25978435-25978457 CCATTTTACGAACCAGGTTAAGG + Intronic
1178631040 21:34261680-34261702 GCATTTTAGTTACCATGTGCGGG + Intergenic
950507322 3:13403447-13403469 GCATTTGAGGTAGCACCTTTGGG - Intronic
958138054 3:89521724-89521746 TCAATTTAGGTAACAAGTTATGG - Intergenic
962525516 3:136234336-136234358 GCAGTTGAGCTACCACCTTATGG - Intergenic
967511651 3:190320351-190320373 GCATTTTAGGTACCACGTTAAGG - Intronic
983819522 4:172175425-172175447 GCATTTGAGGAAGCACGTAAGGG + Intronic
984368521 4:178830414-178830436 GCTTTTTATGTGCCAAGTTACGG + Intergenic
984605910 4:181786219-181786241 GCCTTTTTGGTACCACATAACGG - Intergenic
987535586 5:19183797-19183819 TCATTTTAGATACCACATTCTGG - Intergenic
989274244 5:39568491-39568513 GTAATTTAGGTACCTCGTCAAGG - Intergenic
989850525 5:46203557-46203579 GCATTTTTGGGAGCACATTAAGG + Intergenic
990685590 5:58297137-58297159 ATATTTTAAGTACCACATTAGGG - Intergenic
998763348 5:145456536-145456558 GCATTTTGGGTAGCAGGTTGAGG - Intergenic
999629597 5:153556515-153556537 GCATTTGAGATACTACCTTAAGG - Intronic
1027546191 7:79530036-79530058 GCATTTTAGGCACCAAGGGAGGG - Intergenic
1028706872 7:93859301-93859323 TTATTTTAGGTACCATGTCAAGG + Intronic
1033308491 7:140241968-140241990 GCAGTTGAGGTCCCACGTTTGGG - Intergenic
1043023278 8:75033129-75033151 CCATTATAGGTACCATGATATGG - Exonic
1044368684 8:91382275-91382297 GCCTTTTAGGTGCCATGCTAGGG - Intronic
1048583754 8:135753310-135753332 TCATTTGAGGTACCACTTAATGG + Intergenic
1052005507 9:23343161-23343183 GCATTTTATGTACTATGTTCAGG - Intergenic
1054914403 9:70482586-70482608 GCATTTTAAATACTATGTTATGG - Intergenic
1188328761 X:28842138-28842160 ACATTTTAGGTTCCAAATTATGG - Intronic
1188926722 X:36052653-36052675 GCATTTTATCAACCATGTTATGG + Intronic
1190342446 X:49308474-49308496 GCACTTCAGGTACCACAGTAAGG + Intronic
1197357346 X:125451921-125451943 GCATTTTAAGTAACATGTTTGGG + Intergenic