ID: 967515806

View in Genome Browser
Species Human (GRCh38)
Location 3:190366973-190366995
Sequence CACTCCCACATGCTGCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967515806 Original CRISPR CACTCCCACATGCTGCTTTG GGG (reversed) Intronic
901173952 1:7285016-7285038 CCCTCCCACAGGGTGCTTGGTGG + Intronic
903506380 1:23838536-23838558 CACCCCTACATGCTGCCGTGGGG + Intronic
903641286 1:24862096-24862118 CACTCCCACCTTCTCCTTTAAGG - Intergenic
904346691 1:29877063-29877085 CACCCCTAGATGCTGCTGTGGGG + Intergenic
906608868 1:47188801-47188823 GACTCCCAAATACTGCTTTTTGG - Intronic
907804534 1:57805075-57805097 CAATACCACATGCTGCCTTAGGG - Intronic
914754973 1:150557387-150557409 CACTCCCGCATCCTGGATTGTGG + Intronic
916711504 1:167414501-167414523 CACTCCTACATGTAGATTTGAGG - Intronic
918371564 1:183866777-183866799 CACTGCCACAGGCTACTTTCCGG - Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919365161 1:196650518-196650540 CACCCCTAGATGCTGCTGTGAGG + Intergenic
921891045 1:220353745-220353767 CACCCCCAGAAGCTGCCTTGGGG + Intergenic
922127582 1:222743621-222743643 CAGTACCACATGCTGGTGTGTGG - Intronic
923078561 1:230632258-230632280 GAATCCCTCAGGCTGCTTTGTGG + Intergenic
923099778 1:230803115-230803137 CACTCCCACAGGGTGCCTTTAGG + Intergenic
923215392 1:231844048-231844070 CAGTCTCTCATGCTTCTTTGTGG - Intronic
923333029 1:232943284-232943306 CACTCACACATACTGTGTTGTGG - Intergenic
923811793 1:237326172-237326194 CAAAGCCAGATGCTGCTTTGTGG + Intronic
1064699909 10:18008067-18008089 CACTACCACTTGCTCATTTGGGG - Intronic
1068309796 10:55262930-55262952 CACCCCTAGATGCTGCTTTGGGG + Intronic
1069712198 10:70496938-70496960 CACTCCCAGCTGCAGCCTTGTGG + Intronic
1071220455 10:83459242-83459264 CACCCCTAGATGCTGCTGTGGGG + Intergenic
1071309745 10:84331219-84331241 CACTACTCCATGGTGCTTTGGGG + Intronic
1072127205 10:92457478-92457500 CATTCCACCATGCTGCTTGGAGG + Intronic
1072762288 10:98066677-98066699 CCCACCCTCATTCTGCTTTGGGG + Intergenic
1073483037 10:103798867-103798889 CACTCACTGATGTTGCTTTGTGG - Intronic
1073841044 10:107499407-107499429 CAGTCCCACTGGCTGCCTTGTGG + Intergenic
1076016931 10:127035169-127035191 AACTCCCACATTCTCATTTGAGG + Intronic
1076316909 10:129548722-129548744 CAGTCCCACCTGCAGCTTTCGGG + Intronic
1076329575 10:129654579-129654601 CATTCCCACTGGCTGCTTGGAGG + Intronic
1076445743 10:130512658-130512680 CACTCCCACAGACTGCTGGGTGG - Intergenic
1076768481 10:132650638-132650660 CACTCCCGCAGCCTGCTTGGTGG + Intronic
1078586881 11:12599488-12599510 CACACTCACATTCTGCTCTGGGG - Intergenic
1081376402 11:42363758-42363780 CATTCCCAAATGCTGGTTTGAGG - Intergenic
1081696332 11:45111627-45111649 CACTCCCACTCTCTGATTTGGGG - Intronic
1081951014 11:47043039-47043061 CAGTCCCACTTACTGCATTGTGG - Intronic
1084689512 11:70716823-70716845 CCCTCCCAGATGTTGCTTTGCGG - Intronic
1084694119 11:70743869-70743891 CACCCCCACATGGCTCTTTGTGG + Intronic
1085640745 11:78191172-78191194 CACACACACAGGGTGCTTTGGGG + Intronic
1085923089 11:80982134-80982156 CACCCCTAGATGCTGCTGTGGGG + Intergenic
1085962039 11:81472262-81472284 CACTCCACCTTGCTACTTTGTGG + Intergenic
1088428376 11:109729923-109729945 CACCACCAGATGCTGCTGTGGGG + Intergenic
1088762609 11:112946758-112946780 AACTCCCTCATGCTGCTGGGAGG + Intergenic
1089351115 11:117822266-117822288 CATTCCCACATCCTGCAGTGGGG + Intronic
1090458128 11:126867112-126867134 CAACCCTACATGCTGCCTTGGGG + Intronic
1090529463 11:127575848-127575870 CACTCACACATTCTCTTTTGGGG + Intergenic
1090619345 11:128547876-128547898 CACTCACACTGGCAGCTTTGGGG + Intronic
1091188088 11:133664559-133664581 CCCTCCCTCCTGCTGCTCTGAGG - Intergenic
1093692208 12:22121480-22121502 CACCCCTAGATGCTGCTGTGGGG - Intronic
1094460326 12:30690850-30690872 CACTACCATATGCTGCTGTTGGG - Intronic
1094857531 12:34417268-34417290 CACTCCCAAATATGGCTTTGTGG + Intergenic
1100681651 12:96930246-96930268 CACTCTCACATGCTGTGTTGGGG + Intronic
1102011124 12:109618984-109619006 CACTCCCCAAGGCTGCTATGGGG + Intergenic
1104739682 12:131163728-131163750 CCCCCCCCCATGCTGCCTTGAGG + Intergenic
1104847810 12:131855552-131855574 CTGTCACTCATGCTGCTTTGGGG - Intergenic
1106879437 13:34113162-34113184 CACCCCTAGATGCTACTTTGGGG + Intergenic
1106927756 13:34631212-34631234 CACTCCATCCTGCTGCTCTGTGG - Intergenic
1107156678 13:37175336-37175358 CAACCCCACATCCTGCATTGAGG - Intergenic
1107421439 13:40250979-40251001 CACTGCCACAGGCTTCCTTGGGG - Intergenic
1107594354 13:41947117-41947139 CACTTGCCCATGCTGCATTGGGG + Intronic
1107662580 13:42654224-42654246 CACTCCAAGATACTGTTTTGGGG - Intergenic
1107993018 13:45834795-45834817 CTCTACCACTTGCTGCTGTGTGG + Intronic
1110582951 13:77153278-77153300 CACTCCTAGATGCTGCTGTGGGG + Intronic
1111736068 13:92140847-92140869 CACTTCCAGTTGCTGCTTAGAGG + Intronic
1111878163 13:93921727-93921749 CACACCCAAATGCTGCCTTTTGG - Intronic
1114041751 14:18685168-18685190 CAGTCCCACCTGCTGCTGTAGGG - Intergenic
1117428405 14:55625130-55625152 CTCTGCCACTTGCAGCTTTGTGG + Intronic
1119023767 14:71136692-71136714 CACCCCTAGATGCTGCTGTGGGG - Intergenic
1119087002 14:71748252-71748274 GACTCCCACATGCCTCTCTGTGG - Intergenic
1119467337 14:74869121-74869143 CACTCCTACATATTTCTTTGGGG + Intronic
1121529623 14:94643384-94643406 CACTCCCACAAGCTGCTAGAAGG + Intergenic
1122199442 14:100113626-100113648 CCCTCACACTTGCTGCCTTGTGG - Intronic
1122508434 14:102247125-102247147 CACTCCCACATGGATCTTAGTGG + Intronic
1126187152 15:45841566-45841588 CACCCCTAGATGCTGCTTTGGGG + Intergenic
1129959680 15:79672709-79672731 CCTTCCCCCATGCAGCTTTGAGG + Intergenic
1130916967 15:88312781-88312803 CACTTCCACATGCTACTTTGGGG + Intergenic
1130927313 15:88395429-88395451 CACCCCTAGATGCTGCTATGGGG - Intergenic
1131084922 15:89567957-89567979 CTCTGCCACAGGCTGCTGTGAGG - Intergenic
1134535964 16:15027334-15027356 CACCCCCAGATGCTGCCATGGGG - Intronic
1134873628 16:17675912-17675934 CACTCCTAGATGCTACTATGGGG - Intergenic
1135293576 16:21260752-21260774 CTCTCCCACTTGCTGCTTTGAGG - Intronic
1135887893 16:26328976-26328998 CTCTGCCAGATGCTGCTATGGGG - Intergenic
1136481225 16:30543213-30543235 CACTCCCACATGCATCTTAGTGG - Intronic
1136777919 16:32881492-32881514 TCTTCCCACATGCTGCTCTGGGG + Intergenic
1136892703 16:33980022-33980044 TCTTCCCACATGCTGCTCTGGGG - Intergenic
1137591745 16:49697983-49698005 CACCCCCAGATGCTGCTGTGGGG - Intronic
1138157051 16:54715501-54715523 CACACCCACATGCTGCATTCAGG - Intergenic
1139347133 16:66311147-66311169 CACTCACACACGTCGCTTTGAGG - Intergenic
1140339063 16:74139495-74139517 CACTCCTAGATGCTGCCATGGGG - Intergenic
1142361843 16:89631085-89631107 CACCCGCACCTGCTGCTTTTGGG - Intronic
1142422885 16:89983432-89983454 CACTCACAGCTGCTGCTGTGAGG + Intergenic
1203080337 16_KI270728v1_random:1143601-1143623 TCTTCCCACATGCTGCTCTGGGG + Intergenic
1143271738 17:5680841-5680863 GATTCCCACAAGATGCTTTGGGG - Intergenic
1143465488 17:7133696-7133718 CACCCCCAGATGCTGCCGTGGGG - Intergenic
1146845251 17:36178347-36178369 CACTCCCTCCTGCCGCCTTGTGG - Intronic
1146873465 17:36390190-36390212 CACTCCCTCCTGCCGCCTTGTGG - Intronic
1146880826 17:36441278-36441300 CACTCCCTCCTGCCGCCTTGTGG - Intergenic
1147065923 17:37922683-37922705 CACTCCCTCCTGCCGCCTTGTGG + Intergenic
1147961857 17:44172394-44172416 GACAACCACATGCAGCTTTGTGG + Intronic
1149237323 17:54607493-54607515 CACCCCGAGATGCTGCTGTGGGG + Intergenic
1150908368 17:69362403-69362425 CACTCTCACCTGCTGGGTTGAGG + Intergenic
1151658676 17:75507651-75507673 CCCTCCACCACGCTGCTTTGGGG - Exonic
1152118961 17:78406489-78406511 GCATCCCACGTGCTGCTTTGAGG + Intronic
1153086674 18:1296476-1296498 CACCCCTAGATGCTACTTTGAGG - Intergenic
1155033749 18:22006353-22006375 CAGTACCACAAACTGCTTTGGGG + Intergenic
1155394947 18:25377196-25377218 CACTCCTAGATGCTACTGTGGGG + Intergenic
1157719687 18:49914195-49914217 CACCCCTAGATGCTGCTGTGGGG + Intronic
1158415866 18:57249299-57249321 ACCTCCCACGAGCTGCTTTGAGG - Intergenic
1158533447 18:58284356-58284378 CACTTCCAAAAGCTACTTTGAGG - Intronic
1159376315 18:67598074-67598096 GACTTCCTCATGCTGCTTTTAGG + Intergenic
1159426960 18:68301709-68301731 CACTCCTACATACTGATTTGTGG - Intergenic
1161316658 19:3620488-3620510 CACTCCCACATGCTCCCTTCAGG - Intronic
1165610777 19:37150239-37150261 CATTCCCACATGCTGTGTTAGGG + Exonic
1166332784 19:42088398-42088420 CACTCCCACATACTGGGGTGGGG + Intronic
1167034893 19:46989274-46989296 TACCCCCACATGCTGGTTTTTGG - Intronic
925406863 2:3611611-3611633 AACACCCACATGCTGCTCTGAGG - Intronic
925656611 2:6156493-6156515 CCCTCCCAGATGCTGCCATGGGG + Intergenic
926159740 2:10479013-10479035 CACACCCACATGCTGCTGTGCGG - Intergenic
926372571 2:12194881-12194903 CATTGCCACTTACTGCTTTGTGG + Intergenic
927189725 2:20509344-20509366 CACTCTCACATGATCCTTTCTGG - Intergenic
928184924 2:29101705-29101727 CAGTCCTTCATGCTGCTGTGAGG + Intronic
929339215 2:40792590-40792612 CACTCACACATGCTGATTTAGGG - Intergenic
929782481 2:44965987-44966009 CAATCCCCCATTCTGCTTTAGGG - Intergenic
929960072 2:46489709-46489731 GACTCCCACGTGTAGCTTTGGGG + Intergenic
931252339 2:60544377-60544399 CATTCCCACATCCTGCTGGGGGG + Intronic
935133930 2:100282006-100282028 CACGCCCACATACTGCAGTGTGG - Exonic
935241280 2:101180184-101180206 CACTCCCTCATTCTGTTCTGAGG - Intronic
936577203 2:113667058-113667080 CACTCACAGCTGCTGCTTTGGGG + Intergenic
937542852 2:122980793-122980815 CACACCCAGATGCTGCCTTAGGG - Intergenic
937743673 2:125386239-125386261 CAATCCTACATGCTGCCTTGGGG - Intergenic
938710114 2:133968854-133968876 CAGTCTCTCAAGCTGCTTTGGGG - Intergenic
939067956 2:137506533-137506555 GACTCTCAAACGCTGCTTTGTGG + Intronic
939778281 2:146412854-146412876 CACCCCTAGATGCTGCTGTGCGG - Intergenic
939829421 2:147054211-147054233 CACCCCTAGATGCTGCTGTGGGG + Intergenic
941460096 2:165760454-165760476 GACTGCCAAATACTGCTTTGTGG - Intronic
941512537 2:166431110-166431132 CACTCCAACATGCTGTGCTGTGG + Intronic
941848262 2:170152698-170152720 GACTCCCACACCCTGCTTAGAGG - Intergenic
942054971 2:172173516-172173538 CACCCACACATGCTGATGTGAGG - Intergenic
943749150 2:191493845-191493867 CACTCCTAGATGCTACTGTGGGG - Intergenic
944001428 2:194842984-194843006 CACCCCCGCATGCTGCTGTGGGG + Intergenic
946335778 2:219035611-219035633 CACTCTCTCCTGCTTCTTTGGGG + Exonic
948060006 2:235035860-235035882 CTCTCTCACATGCTCCTTTGGGG + Intronic
1169142716 20:3235344-3235366 CACACACACACGCTGCCTTGTGG + Intronic
1170509613 20:17063398-17063420 CACTCCCTCATTGTGTTTTGTGG - Intergenic
1170780677 20:19422847-19422869 CACTCACACATCCTTCTATGGGG - Intronic
1172828185 20:37808093-37808115 CACACCTACATGCTGCTCGGTGG - Intronic
1174925187 20:54751376-54751398 GACTCCCACATGCTTTTTGGAGG - Intergenic
1179039773 21:37792207-37792229 CCCTCCTATCTGCTGCTTTGTGG + Intronic
1181468268 22:23122422-23122444 CACTCCCACCAGCTGCTGTGGGG - Intronic
1181750364 22:24984970-24984992 CCCTCCAACATGCTCCTTGGTGG - Intronic
1182093237 22:27609968-27609990 CACTCCCACAGGGGCCTTTGAGG + Intergenic
1183705827 22:39474410-39474432 CACACCCACCTGCGGCCTTGGGG - Intronic
1184734260 22:46388827-46388849 CACTCCCACCCGCAGCTCTGAGG - Intronic
1185423029 22:50745606-50745628 CACTCACAGCTGCTGCTTTGGGG - Intergenic
950468784 3:13172035-13172057 CTCTCCCACCTGCTCCTGTGGGG - Intergenic
951342773 3:21509337-21509359 CTATGCCAGATGCTGCTTTGGGG + Intronic
953790493 3:45943690-45943712 CACTGCCATTTGCTGCTGTGTGG + Intronic
954241495 3:49297304-49297326 CCTTCCCACATGCTGCTTCATGG - Intronic
955032764 3:55237075-55237097 CACTCTCACATGCTGCCTGCTGG - Intergenic
955977485 3:64492278-64492300 CACTCCTCCTTGCTGCTATGTGG - Intergenic
956941625 3:74168627-74168649 CACTCTCCCATGCTGGTCTGTGG - Intergenic
957424565 3:80021107-80021129 CACTCCCACCTGCTACTTAGTGG + Intergenic
960877976 3:122315734-122315756 CACCCCTAGATGCTGCTGTGGGG + Intergenic
961880263 3:130056754-130056776 CAATTCCACAAGCTGCTGTGGGG + Intergenic
962438983 3:135394621-135394643 CACTCCTACAGGCTGCTCTGTGG + Intergenic
964136538 3:153351304-153351326 CACCCCTAGATGCTGCTGTGCGG - Intergenic
964717011 3:159732961-159732983 CACCCCCACCTCCTGCTCTGTGG - Intronic
967217740 3:187224687-187224709 CCCTTCTACATTCTGCTTTGTGG + Intronic
967515806 3:190366973-190366995 CACTCCCACATGCTGCTTTGGGG - Intronic
967899055 3:194428384-194428406 CATTGCCAGATGCTCCTTTGGGG - Intronic
968512152 4:1000519-1000541 GGCTCCCACATGCTCCGTTGTGG + Intronic
968598601 4:1498317-1498339 TTCACCCAAATGCTGCTTTGTGG - Intergenic
968992650 4:3925109-3925131 CAATTCCACACGCTGCTGTGGGG + Intergenic
970545607 4:17127258-17127280 CACTCCAAGATGCTGCTTTGTGG - Intergenic
970545747 4:17128366-17128388 CACTCCAAGATGCTGTTTTGTGG - Intergenic
971427305 4:26529273-26529295 CACCCCTAAATGCTGCTGTGGGG - Intergenic
971455110 4:26836795-26836817 CATTCACACTTGCTGCTGTGAGG - Intergenic
971985506 4:33817613-33817635 CACTCCCAATTGCTGCTGTTTGG - Intergenic
973492049 4:51158188-51158210 CATTCTCACAAACTGCTTTGTGG + Intergenic
974169341 4:58245836-58245858 CACTCCTAGATGCTGCCGTGAGG + Intergenic
974189698 4:58488826-58488848 AACTCCTTCATGCTGGTTTGGGG + Intergenic
975142472 4:70932675-70932697 CACTGCCCCATGCTGCTTGTTGG + Intronic
977923353 4:102670186-102670208 GACTCAGACAGGCTGCTTTGGGG - Intronic
978326420 4:107562210-107562232 AACTCCCACACGCCCCTTTGTGG + Intergenic
979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG + Intronic
981274627 4:142884153-142884175 ATCTCACACATGCTGCTCTGTGG + Intergenic
984095549 4:175428420-175428442 CCCACCCACATGCTGCTGTTTGG - Intergenic
985636663 5:1039015-1039037 CACTGCCGCATGCTGCCCTGTGG - Intergenic
987029426 5:13962147-13962169 AGCTTCCTCATGCTGCTTTGTGG + Intergenic
987268322 5:16278916-16278938 CACTCCTAGATGCTACTGTGGGG + Intergenic
987276935 5:16372669-16372691 CACTCTGCCATGCTGCTGTGAGG - Intergenic
988824274 5:34918792-34918814 GACTGCCACATGTTGCTTTTTGG + Intronic
992226048 5:74620551-74620573 CACCTCCAGATGCTACTTTGGGG - Intergenic
992506429 5:77391613-77391635 CACATGCACATCCTGCTTTGGGG - Intronic
995430388 5:112068066-112068088 CTCTCCTCCATTCTGCTTTGTGG - Intergenic
996131832 5:119790850-119790872 CACAACCACATGCTACTTGGAGG + Intergenic
998616944 5:143751421-143751443 CACTCCTGAATGTTGCTTTGAGG + Intergenic
1001019468 5:168170737-168170759 CACTCCCTCTGGCTGCTGTGTGG - Intronic
1001260787 5:170226844-170226866 CCCTCCCACATGAGGCTGTGTGG + Intergenic
1001456493 5:171865183-171865205 CACTCTCAAATGCTGCTGAGGGG + Intronic
1001962004 5:175885073-175885095 CACTCAGACATGATGCTCTGTGG - Intergenic
1002618325 5:180469033-180469055 CATTCCCACATGCTTCCGTGTGG - Intergenic
1003586909 6:7399070-7399092 CACCCACACTTCCTGCTTTGTGG - Intronic
1003896010 6:10608445-10608467 TACTCCCACTTGCGGGTTTGAGG + Intronic
1005111598 6:22288079-22288101 TACTCACACTTGATGCTTTGGGG + Intronic
1006750402 6:36373307-36373329 CACCCCCACCTCCTGCTCTGGGG - Intronic
1008247374 6:49194512-49194534 CACTCCCATATGTTTCTTTATGG - Intergenic
1011873470 6:91926618-91926640 CACTCCTAGATGCTGCCTTGGGG - Intergenic
1015746128 6:136511670-136511692 CACTCCCACCTGCTGCTCTGTGG - Intronic
1016858167 6:148692905-148692927 CACTCCCTCCTGCTCCTCTGAGG + Intergenic
1017188829 6:151630043-151630065 CACTCCGACTTCCTGGTTTGGGG + Intergenic
1017712200 6:157180940-157180962 CACCTCCACATGCTGCTTCTGGG + Intronic
1019163168 6:170082301-170082323 CCCTCCCACCTTCTGCTGTGGGG + Intergenic
1021395008 7:20136720-20136742 TTCTCCCACATGCTGCTGTATGG - Exonic
1023835202 7:44063846-44063868 CCCTCCCACAGCCTGGTTTGGGG - Intronic
1024173091 7:46810461-46810483 CACTCCTAGATGCTACTGTGGGG - Intergenic
1025585997 7:62788249-62788271 CACTCCCACATGTATCTTTGCGG - Intergenic
1027230365 7:76268462-76268484 CACTCCCAGCTGAGGCTTTGGGG - Intronic
1027888357 7:83938043-83938065 CACTCCTAGATGCTGCCATGGGG + Intergenic
1031681521 7:124680897-124680919 CACCCCCAGATGCTGCCATGGGG + Intergenic
1031696213 7:124857934-124857956 CCCTCTCAGATGCTGCTGTGGGG + Intronic
1031766211 7:125781066-125781088 CACTCCTAGATGCTGCCTTGGGG - Intergenic
1032472353 7:132187686-132187708 CACTCCCCCAAGCTGCCTTCTGG + Intronic
1035114813 7:156515797-156515819 TATTCCCACAGGCTGCTGTGTGG + Intergenic
1035745361 8:1958734-1958756 CATCACCACTTGCTGCTTTGGGG + Intergenic
1035824713 8:2631897-2631919 CACACCCAAATGTTGCCTTGTGG - Intergenic
1036117070 8:5970297-5970319 CACTCCAACATGCGGCTCAGGGG + Intergenic
1036466667 8:9003989-9004011 CACTTCCATTTGCTGCTCTGCGG + Intronic
1039833355 8:41235758-41235780 CACAGCCACATTCTGCTGTGGGG - Intergenic
1039862484 8:41470945-41470967 CACACCCACACCCTGATTTGTGG - Intergenic
1040357994 8:46638270-46638292 CCCTCCCACATGGTGAATTGTGG + Intergenic
1040498893 8:47990458-47990480 CACTCCCACATGGATCTTAGTGG - Intergenic
1044086855 8:87953086-87953108 CACCCCAACCTGCTGCTTTCAGG + Intergenic
1045872140 8:106939204-106939226 CACTCACCCCTGCTGTTTTGTGG + Intergenic
1046906669 8:119581351-119581373 CCCTCCCACACCCTGCTCTGTGG + Intronic
1047915232 8:129575781-129575803 CAGGCCCAAATGCTTCTTTGAGG - Intergenic
1048158820 8:131992196-131992218 CATGACCACATACTGCTTTGTGG + Intronic
1048300429 8:133247432-133247454 AACTCCCACCTGCAACTTTGTGG - Intronic
1048879627 8:138861594-138861616 CCCTCTCTCTTGCTGCTTTGGGG + Intronic
1049553990 8:143273321-143273343 GACCCCCACATCCTGCTTTGGGG + Intronic
1050202113 9:3156773-3156795 CACCCCTACATGCTGCTGTGGGG - Intergenic
1052370172 9:27655394-27655416 CACTCCCAGACACTGCTGTGGGG + Intergenic
1052608133 9:30732275-30732297 CACCCCTAGATGCTGCTGTGGGG - Intergenic
1054723889 9:68630976-68630998 CACACCCACATTTTGCTCTGGGG + Intergenic
1055279613 9:74659289-74659311 GACAGCCAAATGCTGCTTTGAGG + Intronic
1056177104 9:84045684-84045706 CACTGCTACAGGCTGCTATGGGG - Intergenic
1056608268 9:88105759-88105781 CACTCCCTCATTCTACTTTCGGG + Intergenic
1057713666 9:97470065-97470087 CCATCACAAATGCTGCTTTGGGG + Intronic
1059499658 9:114740245-114740267 CTTTCCCATATGATGCTTTGTGG + Intergenic
1203434958 Un_GL000195v1:129816-129838 CCCTGCCACAGGCTTCTTTGAGG - Intergenic
1186036436 X:5428651-5428673 CACCCCTACATGCTGCCATGTGG - Intergenic
1186332426 X:8548987-8549009 CACTCCCAGCTTCTCCTTTGTGG + Intronic
1186873495 X:13794829-13794851 CACTGTCACACGCTGGTTTGTGG - Intronic
1186961180 X:14737944-14737966 CTCTGCCATATGCTGCATTGGGG - Intergenic
1187089431 X:16079727-16079749 CTCTCCAACATACTGATTTGGGG + Intergenic
1187326548 X:18295500-18295522 CATGAACACATGCTGCTTTGGGG + Intronic
1190326346 X:49209382-49209404 CACCCCCACAGGCTGGTCTGCGG - Exonic
1190950817 X:55141048-55141070 CATTCCCTCCTGCTGCTTTGTGG + Intronic
1193183591 X:78486641-78486663 CACCCCTAGATGCTGCTGTGGGG - Intergenic
1195462070 X:105138784-105138806 TACTCCCAAATGCTGATTTGAGG - Intronic
1197767730 X:130069931-130069953 CACTCCAACCCCCTGCTTTGGGG + Intronic
1200101914 X:153692544-153692566 TCTTCCCACATGCTGCTCTGGGG - Intronic
1200934831 Y:8729258-8729280 CACTCCTCCAAGCTGCTTGGAGG - Intergenic