ID: 967518681

View in Genome Browser
Species Human (GRCh38)
Location 3:190402142-190402164
Sequence CTGACAATTGAAGCCTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967518681 Original CRISPR CTGACAATTGAAGCCTTTCT GGG (reversed) Intronic
908357988 1:63340831-63340853 CTAACATTTGATTCCTTTCTTGG + Intergenic
909669886 1:78176666-78176688 CTGCCAAGTGAAGCTTTTATAGG + Intergenic
911195233 1:94987873-94987895 CTTAAAATTGAAGCCTTAATTGG - Intronic
912186102 1:107277501-107277523 CTAACAATTGAAGCTTACCTAGG - Intronic
913351456 1:117865440-117865462 CTGTCAATTTAAGCATTTTTAGG + Exonic
914353048 1:146856748-146856770 CTCACATTTGAAACATTTCTGGG - Intergenic
916005787 1:160658776-160658798 CTCACACTTGAATTCTTTCTTGG - Intergenic
920554189 1:206892004-206892026 CTGAAATTTGAAGCCTGACTAGG - Intergenic
920566967 1:206981861-206981883 CTGACAATTGAAGAATCTTTCGG + Intergenic
921808317 1:219480784-219480806 CTGACACTTCAAGACATTCTTGG - Intergenic
922928132 1:229367673-229367695 CTGACAAATGAGGCTTTTGTAGG + Intergenic
923458856 1:234189210-234189232 CTGGCAATTCAAGCATTTCTTGG - Intronic
1063056960 10:2516013-2516035 TGGAAAATGGAAGCCTTTCTGGG + Intergenic
1064020781 10:11806847-11806869 CTCACAATAGAAGCCATACTGGG - Intergenic
1071537824 10:86450534-86450556 CTGCTAAATGAAGCATTTCTTGG - Intronic
1074986522 10:118664555-118664577 CTGACTCTGGCAGCCTTTCTTGG + Intergenic
1075260756 10:120962181-120962203 CTGACAATTGAGTTGTTTCTGGG - Intergenic
1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG + Exonic
1078464691 11:11541567-11541589 CTGACATATAAAGCCTTCCTGGG + Intronic
1080802619 11:35621549-35621571 ATGACATTTGGACCCTTTCTAGG + Intergenic
1080919527 11:36694907-36694929 CTTACACTTGAAGAATTTCTTGG - Intergenic
1081737237 11:45412569-45412591 ATTATAATTTAAGCCTTTCTTGG - Intergenic
1081836335 11:46158399-46158421 TTGACACTTGAATCATTTCTAGG + Intergenic
1088072097 11:105799694-105799716 CTAAAAATTGAAGCCTTCATAGG - Intronic
1092005065 12:5062147-5062169 CTTACAATTTTGGCCTTTCTAGG + Intergenic
1094044070 12:26147711-26147733 CTGACAATAGAAGACTTTTAAGG + Intronic
1099565429 12:84237796-84237818 CTGATAATTAAAGATTTTCTTGG - Intergenic
1101260016 12:103019469-103019491 CTACCAATAGAAGCCTTTCTAGG - Intergenic
1101744651 12:107530047-107530069 CTAACAATTGAAGACCTTCAAGG - Intronic
1102334544 12:112066936-112066958 GGGACAATAGAAGGCTTTCTGGG + Intronic
1103601817 12:122059306-122059328 CTGAGAAGTGACGCCGTTCTGGG - Exonic
1103694277 12:122801641-122801663 CAGAAAAATGAAGCCTGTCTGGG + Exonic
1105331924 13:19425710-19425732 CTGAGAGTGGAAGCCTTTATTGG - Intronic
1105879881 13:24595080-24595102 CTGAGAGTGGAAGCCTTTATTGG + Intergenic
1105919969 13:24954054-24954076 CTGAGAGTGGAAGCCTTTATTGG - Intergenic
1107614602 13:42152553-42152575 GTAACACATGAAGCCTTTCTTGG + Intronic
1108625269 13:52222504-52222526 CTGAGAGTGGAAGCCTTTATTGG - Intergenic
1108660789 13:52583912-52583934 CTGAGAGTGGAAGCCTTTATTGG + Intergenic
1110044126 13:70807735-70807757 ATGACAAGGGCAGCCTTTCTAGG + Intergenic
1113296642 13:108965938-108965960 CTGAAAATTGATGCCTTTAGAGG + Intronic
1115530629 14:34323823-34323845 CTAACAATGGAAGGATTTCTAGG - Intronic
1116641396 14:47468139-47468161 CTAACAATCCAAGCATTTCTAGG + Intronic
1120322840 14:82987752-82987774 CTGACAACTGATGGCTTTATAGG - Intergenic
1122283510 14:100638049-100638071 CTGACACGTGAAGCCTTTCGTGG + Intergenic
1122690467 14:103529753-103529775 CTGGCCTCTGAAGCCTTTCTTGG - Intronic
1124560820 15:30771673-30771695 CTGAGAGCTGAAGCCTTTATGGG + Intronic
1126487288 15:49195649-49195671 CTGACATTATAAGGCTTTCTGGG + Intronic
1127396225 15:58545958-58545980 CTCACCATTGAAGCCGTGCTGGG - Exonic
1130458777 15:84142177-84142199 CTGAAAAATGAAACCTTTATTGG + Intergenic
1131424783 15:92336779-92336801 ATGCCAAGTGAAGCCTTTCTTGG - Intergenic
1135353738 16:21752183-21752205 CTGACACTTGGCACCTTTCTGGG + Intronic
1135452227 16:22568311-22568333 CTGACACTTGGCACCTTTCTGGG + Intergenic
1135851646 16:25969117-25969139 GTGACAATTGAAACCTTTGTTGG - Intronic
1137381903 16:48007112-48007134 CTGACAATTCTAACCTTTTTAGG + Intergenic
1137699098 16:50483107-50483129 CTGTCAAATGCAGCCTATCTTGG + Intergenic
1137705348 16:50531817-50531839 CTGGCAATTGAGACCTTCCTTGG - Intergenic
1138854169 16:60667816-60667838 CTGAGAATTCAAGCCATTCCAGG + Intergenic
1139980978 16:70858770-70858792 CTCACATTTGAAACATTTCTGGG + Intronic
1146998284 17:37340368-37340390 CTGACAATTTAAATCTATCTAGG + Intronic
1153138877 18:1949109-1949131 CTAACAAATTAAGTCTTTCTTGG - Intergenic
1153466119 18:5389583-5389605 AGAAGAATTGAAGCCTTTCTTGG + Intergenic
1153497324 18:5712766-5712788 TGGACAATTGAAGCCCTTCATGG + Intergenic
1153654280 18:7268983-7269005 ATAATAATTGAAGGCTTTCTGGG - Intergenic
1157080087 18:44515163-44515185 TTGAAAATTGAAGAATTTCTTGG + Intergenic
1158457374 18:57620137-57620159 CTGACAAATGAATCCATTCTTGG + Intronic
1159131518 18:64285543-64285565 CTGACAGATGGAGCTTTTCTTGG - Intergenic
1159197046 18:65130446-65130468 CTGGCAATTTATGTCTTTCTAGG + Intergenic
1160081643 18:75733194-75733216 CTGAAAATTCACACCTTTCTTGG + Intergenic
1160495018 18:79368215-79368237 AGGAAAATTGAAGACTTTCTTGG - Intronic
1161750372 19:6091922-6091944 CAGAGAATTGTAGACTTTCTGGG + Intronic
1163309389 19:16504101-16504123 CTGAGAATTGGAGCCTGCCTGGG + Intronic
1164569064 19:29356346-29356368 CTGGCACTTGAATCCTTTCTAGG + Intergenic
1164679348 19:30123463-30123485 CTGACTGATGGAGCCTTTCTGGG + Intergenic
926224086 2:10955085-10955107 CTGGCAAGTGAAGCCTTGCCTGG + Intergenic
927251921 2:21003590-21003612 CTTAAAATTAAAGCCTTCCTAGG + Intronic
927479927 2:23444742-23444764 CTACCAAGTGAAGCTTTTCTTGG + Intronic
928918072 2:36495193-36495215 CGGAGAATACAAGCCTTTCTAGG - Intronic
929778952 2:44945083-44945105 GTGACAATTGTATACTTTCTAGG + Exonic
931193513 2:60028149-60028171 CTGAGATCTGAAGCCTGTCTTGG - Intergenic
932689104 2:73897297-73897319 CTTACAGTTCAAGCCTGTCTGGG - Exonic
933353651 2:81188959-81188981 TTCACAATTGAAGCCTCTTTTGG + Intergenic
933359812 2:81267267-81267289 ATGACAATTCAAGCCTATCATGG + Intergenic
935081249 2:99797148-99797170 CTGACACCTGTGGCCTTTCTGGG - Intronic
939536925 2:143443002-143443024 GTGACCATTGAGACCTTTCTGGG + Intronic
940765579 2:157786442-157786464 CTGACATTTAAAGACTTTATGGG - Intronic
946917755 2:224543206-224543228 CTGAAAATTGAGGACTTCCTTGG + Intronic
948403451 2:237701068-237701090 CTGAGCATTGAAGCTTTTCTGGG - Intronic
1168797916 20:623874-623896 CTCACAAGTATAGCCTTTCTGGG - Intergenic
1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG + Intronic
1176741080 21:10602846-10602868 CTGAGAGTGGAAGCCTTTATTGG + Intronic
1183350646 22:37332936-37332958 CTGACAATTGTAGGGTCTCTTGG - Intergenic
949578215 3:5359726-5359748 CTGATAAATGAATCCTATCTAGG + Intergenic
950219596 3:11184501-11184523 CTGAGAATTTATGCCTGTCTGGG - Intronic
955533402 3:59898326-59898348 CTGACAACTGAACCACTTCTAGG + Intronic
960564585 3:119119691-119119713 CTGAGAATTGAAATTTTTCTGGG - Intronic
964122575 3:153201155-153201177 GAGATAGTTGAAGCCTTTCTAGG + Intergenic
967518681 3:190402142-190402164 CTGACAATTGAAGCCTTTCTGGG - Intronic
967952882 3:194854211-194854233 GAGACAAGGGAAGCCTTTCTTGG - Intergenic
973024588 4:45251446-45251468 CTTACAATTGACACCTTACTTGG + Intergenic
976629952 4:87225939-87225961 CTGAGAATTCAACCCTATCTAGG - Intronic
977528932 4:98176876-98176898 CTGAAAATGGTTGCCTTTCTTGG + Intergenic
979338998 4:119498146-119498168 GTGACATTTAAAGCCTTTATAGG - Exonic
979754927 4:124328417-124328439 CTGAAAATGGAAGCTTTTCTGGG + Intergenic
984772540 4:183450178-183450200 CTGCCAAGTGCAGCTTTTCTTGG + Intergenic
986609137 5:9549497-9549519 CTGACAAAAGAAACCTGTCTGGG - Intergenic
986790753 5:11157350-11157372 CTGACTCTTCAAGCCTTTTTTGG + Intronic
988282979 5:29173671-29173693 CTGTGAGTTGAAGCCTTTTTTGG - Intergenic
990908834 5:60833367-60833389 CTGAGAATTGAAGCCTTTGCTGG - Intronic
994445368 5:99865209-99865231 CTGAAAATCAAAGCTTTTCTTGG - Intergenic
997024608 5:130043911-130043933 CTGACAATAGAGGCCTTGCATGG - Intronic
997557025 5:134809187-134809209 CTGAAAATTGTAGCCTATTTGGG + Intronic
1001645472 5:173278525-173278547 CTGACAACTCAAGCTCTTCTGGG - Intergenic
1003056740 6:2827748-2827770 ATGACAATTGCAGCATTTCGGGG - Intergenic
1006296795 6:33173401-33173423 CTGACAACTGAACCCCTTCCAGG - Exonic
1006667177 6:35703762-35703784 TTCAGAATTGAAGTCTTTCTTGG - Intronic
1008897979 6:56579760-56579782 CTGATGTTTGAAGCCTTTCCAGG - Intronic
1009039479 6:58159192-58159214 TTGACAATTCAACACTTTCTTGG + Intergenic
1009215372 6:60914032-60914054 TTGACAATTCAACACTTTCTTGG + Intergenic
1016648624 6:146438783-146438805 ATGACGATTGAAGCCCTGCTGGG - Intergenic
1018263812 6:161998317-161998339 CTGAGAAATGAAGCGTTTCTTGG - Intronic
1018596005 6:165481270-165481292 CTCACAATTGAAGAGTTCCTTGG - Intronic
1018833284 6:167462784-167462806 GTGACACTTGGAGCCTTTTTTGG - Intergenic
1020502014 7:8935239-8935261 CTGGTAAATGAAGCCTTACTGGG + Intergenic
1021935011 7:25621610-25621632 CTGACCAGTGAAGCCATGCTTGG - Intergenic
1021947096 7:25738652-25738674 GTGACAATTGAGGACTTGCTGGG - Intergenic
1023696599 7:42854373-42854395 CTGACAAATGAACCAATTCTAGG + Intergenic
1028346900 7:89794088-89794110 TTGACAATTCAAGCTTTTTTGGG + Intergenic
1029554883 7:101261769-101261791 GTGGGAATTGAAGCCTTTCTAGG + Intergenic
1039071535 8:33653222-33653244 CTGACAGGTTAAGCCTTTATAGG + Intergenic
1040139439 8:43893485-43893507 CTGACATGTGATGTCTTTCTCGG + Intergenic
1040532713 8:48278628-48278650 AGGATAATTGAAACCTTTCTGGG + Intergenic
1043914966 8:85911637-85911659 ATTACACCTGAAGCCTTTCTAGG + Intergenic
1044192234 8:89332659-89332681 CTCAAAATTGCAGCCTTTCGAGG + Intergenic
1045772032 8:105753406-105753428 GTGATAATTGAAGCTGTTCTTGG + Intronic
1048586979 8:135783410-135783432 CTGAGAAGTGGAGCCTTTGTGGG - Intergenic
1050754942 9:8990804-8990826 CTGAACAGAGAAGCCTTTCTGGG + Intronic
1052292782 9:26863348-26863370 CAAACTATTGAAGACTTTCTGGG - Intronic
1054803203 9:69373304-69373326 CTGACAAATGAAACCTTTTTGGG + Intronic
1055090280 9:72357822-72357844 CTGAAACTTAAAGCCTTTTTAGG - Intronic
1055455180 9:76465516-76465538 CACAGAATAGAAGCCTTTCTTGG - Intronic
1057933482 9:99216339-99216361 CTGAGAAATGCAGCCTTTCCAGG - Intergenic
1059331981 9:113541454-113541476 CTGGCAACTTAACCCTTTCTTGG + Intronic
1059586497 9:115613036-115613058 GTGATAAATGATGCCTTTCTGGG - Intergenic
1060655953 9:125372999-125373021 CTGACACATGATGCCTTTCTGGG + Intergenic
1189920001 X:45894302-45894324 CTGACAATTCTACCTTTTCTAGG + Intergenic
1193827090 X:86240142-86240164 CTGTCATTTGAAGCCAGTCTTGG + Intronic
1193856991 X:86615220-86615242 ATGACATTTCAAGCATTTCTGGG + Intronic
1195772612 X:108367779-108367801 CTGATAATTGTTTCCTTTCTTGG - Intronic
1196085993 X:111682485-111682507 CTGACACTTGAACCTTTTCGAGG + Intronic
1197751685 X:129968528-129968550 CTGACAAATTAAGCATTACTTGG + Intergenic
1199187782 X:144937732-144937754 CTGACATTTTAAGCATTTCCTGG - Intergenic
1199191522 X:144977371-144977393 CTTACAAATGAGGGCTTTCTGGG - Intergenic
1201342035 Y:12944633-12944655 TTGACATTTGAAAACTTTCTAGG - Intergenic