ID: 967519294

View in Genome Browser
Species Human (GRCh38)
Location 3:190410235-190410257
Sequence AAGTGTGTGCATAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967519294_967519299 6 Left 967519294 3:190410235-190410257 CCTTCCACCTTATGCACACACTT 0: 1
1: 0
2: 0
3: 17
4: 238
Right 967519299 3:190410264-190410286 TATTTTAAGATAAGTCTGCTAGG 0: 1
1: 0
2: 2
3: 33
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967519294 Original CRISPR AAGTGTGTGCATAAGGTGGA AGG (reversed) Exonic
902595545 1:17507279-17507301 GTGTGTGTGCATGTGGTGGAAGG - Intergenic
904410291 1:30320873-30320895 AAGTGTGGGCAGAAGGGGGGTGG + Intergenic
904648494 1:31986718-31986740 GAGTGGGTGCAGGAGGTGGAGGG - Intergenic
905637300 1:39563187-39563209 AAGTGTGTGTAGGAGGTGAAGGG - Intronic
906488504 1:46249258-46249280 CAGTGTGTGAATAAGGTGTGGGG + Intronic
906491644 1:46273375-46273397 AAGTGTGTGGAAGAGGAGGATGG + Exonic
906740686 1:48180870-48180892 AAATGTGTGAATAAGGTGTAGGG - Intergenic
910513189 1:88028803-88028825 AAGTGTGTTCTTGTGGTGGATGG + Intergenic
912976143 1:114332005-114332027 AAGGGTGAGCAAAAGGTGAAAGG - Intergenic
912992297 1:114500551-114500573 AAGAGTGAGCAAAAGGTGAATGG + Intronic
915053105 1:153097211-153097233 AAGTGTTTGCACAAAGTGAATGG - Intronic
917723315 1:177807046-177807068 AATTTTTTGCATAAGGTGTAAGG - Intergenic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920526775 1:206672923-206672945 AAGTGTGTGCATCAGTGGGAGGG - Intronic
920818397 1:209356951-209356973 GAGTTTCTGCATCAGGTGGAAGG + Intergenic
920992410 1:210952241-210952263 AAGGGTGTGAATGAGCTGGAGGG - Intronic
922935047 1:229416124-229416146 AAGTGTATGCATCAGGTGTGAGG - Intergenic
1063374985 10:5548884-5548906 ATGTGTGTGGATAAGGGAGAGGG - Intergenic
1064314949 10:14246835-14246857 AAGATTGTGCTTCAGGTGGAAGG + Intronic
1064668400 10:17682154-17682176 TAGTACTTGCATAAGGTGGAAGG - Intronic
1064797707 10:19032231-19032253 AAGAATGTGCATAAAGTAGACGG - Intergenic
1066050929 10:31634326-31634348 AGGTTGGTGCATAAGGTTGAAGG + Intergenic
1070311369 10:75276175-75276197 AAGTGTGTGCATGGGTTGGCGGG + Intergenic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1074092593 10:110275619-110275641 AACTGTGTGCATTATTTGGATGG + Intronic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1075183515 10:120233530-120233552 AAGTATGGGCATCTGGTGGATGG + Intergenic
1075190943 10:120308119-120308141 AAGTGGTTGAATAAGGTGGCAGG + Intergenic
1075494587 10:122908964-122908986 AAGTAAGTGACTAAGGTGGAAGG - Intergenic
1076459692 10:130633206-130633228 AAATGTGTGCCTGAGGTGGTTGG + Intergenic
1078069075 11:8096557-8096579 GAGTGTGTGCATAAGTTTGTGGG + Intronic
1078246481 11:9576583-9576605 AAGTGTGTGAAGAGGCTGGATGG + Exonic
1081312998 11:41595867-41595889 AAGTGTGTGCACAAGACTGAGGG - Intergenic
1081549562 11:44098745-44098767 ATGTGTTTGCATATGGTGGGTGG + Intronic
1084250103 11:67891348-67891370 AAGTATTTGCCTAAGCTGGATGG + Intergenic
1084822683 11:71704014-71704036 AAGTTTTTGCTTAAGCTGGATGG - Intergenic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1086079497 11:82888782-82888804 AGGTGTGTGTATATGGAGGAGGG - Intronic
1089827884 11:121295406-121295428 AAATGTGTGCATTCAGTGGAAGG - Intronic
1090145191 11:124313813-124313835 AAATGTGTGTATAAGGTAGTGGG - Intergenic
1090380670 11:126325409-126325431 ATGTGTGTGCATTTGGTGAAGGG + Intronic
1090572502 11:128062793-128062815 ATGTGTGTGGATAATGTGAAGGG - Intergenic
1092203505 12:6601795-6601817 AAGTGTGGGCACTAGGTGGCAGG - Intronic
1092420430 12:8326868-8326890 AAGTTTTTGCTTAAGCTGGATGG + Intergenic
1092736166 12:11585101-11585123 AGGTGTGTTCACGAGGTGGAAGG - Intergenic
1093730079 12:22557086-22557108 CACTGTGCGCATGAGGTGGAAGG - Intergenic
1094744492 12:33329270-33329292 AAGTGTGTGTATTGGATGGAAGG - Intergenic
1095572257 12:43696680-43696702 AAGTGTGTGCAAAAGGAGGGTGG - Intergenic
1095998756 12:48111880-48111902 AAGTATATGCATCAGGTGTAAGG + Intronic
1096221138 12:49828615-49828637 AAGTGTTTCTATAAGGGGGAAGG - Intronic
1097983979 12:65763699-65763721 AGCAGTGTGCATAAGGTTGATGG - Intergenic
1098140806 12:67448562-67448584 AGGTGTGTATACAAGGTGGAGGG - Intergenic
1098233815 12:68398996-68399018 AAGTGTGTGTCCAAGATGGAAGG - Intergenic
1098920178 12:76295578-76295600 AAGTATATGCATCAGGTGGGAGG - Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1099899736 12:88693086-88693108 TCGTGTGTGCAGAAGGGGGAGGG + Intergenic
1100054091 12:90488295-90488317 AAGTGTTTGCAAAGGTTGGAGGG + Intergenic
1100875119 12:98953593-98953615 AGGAATGTGCATGAGGTGGAGGG - Intronic
1101163649 12:102005824-102005846 AAGTGTTTGTCTGAGGTGGATGG + Intronic
1101569168 12:105937215-105937237 ATGTTTGTGCATGAGGTGGGAGG - Intergenic
1101921756 12:108938750-108938772 GAGTGTGTGCATATGGAGTAGGG - Intronic
1106112335 13:26787774-26787796 ATGGGTGTGCATTAGATGGAAGG - Intergenic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1108601820 13:52001409-52001431 GAGTGTGAGGATAAGTTGGAAGG - Intronic
1109779378 13:67087647-67087669 AAGTGTGTGTAACAGGAGGATGG - Intronic
1111044775 13:82800061-82800083 AAGTGTGTTTATAAGGTCTATGG - Intergenic
1111215452 13:85134594-85134616 AAGTGTGTTTATAAGGTGAAGGG - Intergenic
1111987731 13:95081667-95081689 AAGTGTCTGCATGAAGTAGAAGG - Intronic
1112706152 13:102071187-102071209 AAGTGTGTGCACATCGTGGGTGG + Intronic
1113861216 13:113488841-113488863 AAGTGTGTACATGGGGTGGGGGG + Intronic
1114919037 14:27303179-27303201 AAGTGAATGCATTTGGTGGAAGG + Intergenic
1115646429 14:35371452-35371474 AAGTGTGTGCTGAATGTGGATGG + Intergenic
1118764227 14:68899374-68899396 AGGTGTGTGTATGAGGTGTATGG - Intronic
1118860635 14:69660350-69660372 AAGTGTCAGAATAGGGTGGAAGG - Intronic
1120612872 14:86664495-86664517 AAGTGTGTTCATACGTGGGATGG - Intergenic
1121164449 14:91778264-91778286 AAGTTTGTGGATATGGTGGTAGG + Intronic
1121168548 14:91834260-91834282 AATTGTGTTCATAATTTGGATGG + Intronic
1121433947 14:93906556-93906578 AAGTGTGTGGAATAGCTGGATGG + Intergenic
1121551637 14:94807215-94807237 AAATGTTTGCAGAAGGTAGAAGG - Intergenic
1121779593 14:96613817-96613839 AAGTGTCCTCATAGGGTGGATGG - Intergenic
1122034766 14:98939304-98939326 AAGTGGGTGAATAAGGGGCAGGG - Intergenic
1122329136 14:100901272-100901294 GCGTGTGTGCATATGGGGGATGG - Intergenic
1123409246 15:20044705-20044727 AGCTGGGTGCATGAGGTGGAGGG + Intergenic
1123518577 15:21051413-21051435 AGCTGGGTGCATGAGGTGGAGGG + Intergenic
1125345110 15:38711387-38711409 AAGTGAGTGCATAATTTGGATGG + Intergenic
1125378834 15:39064420-39064442 AAGTGTGTGCACCAGGGGTAGGG + Intergenic
1126540873 15:49821952-49821974 AAGTGAGTAAATGAGGTGGAAGG - Intergenic
1128528011 15:68425586-68425608 AGGTGTGTCCATTAGATGGATGG - Intronic
1129770581 15:78201035-78201057 AAGTGTGGGCATGTGATGGAGGG - Intronic
1130110670 15:80961146-80961168 AATTGTGTGCATAAAGTTTAGGG - Intronic
1131054996 15:89369807-89369829 AACTGTGTGGCTGAGGTGGATGG + Intergenic
1131727203 15:95239634-95239656 AAGGAAGTGCATAAGGTGAAGGG - Intergenic
1133359129 16:5159893-5159915 AAGTTTTTGCTTAAGCTGGATGG + Intergenic
1134136371 16:11679016-11679038 AAGTTTGTGCAATAAGTGGAAGG + Exonic
1136026481 16:27472080-27472102 GAGTGTGTGTATCAGGGGGAGGG + Intronic
1137363694 16:47842526-47842548 AAGTATATGCATCAGGTGGGAGG - Intergenic
1138974547 16:62187901-62187923 AAACATGTGCCTAAGGTGGATGG - Intergenic
1139002238 16:62526366-62526388 AAGTATGTATATATGGTGGATGG - Intergenic
1139027365 16:62834734-62834756 AACTGTGTGCCTAAGATGGAAGG + Intergenic
1139669420 16:68482053-68482075 AAGGATGTACATTAGGTGGAAGG - Intergenic
1139694107 16:68661050-68661072 AAGTGTATGTATGGGGTGGAGGG + Intronic
1150814684 17:68383718-68383740 AAGTGCGTGAATAAATTGGAGGG + Intronic
1151502996 17:74504316-74504338 AAGTATATGCATCAGGTGGGAGG - Intergenic
1152387168 17:79981491-79981513 AAGTGTGTGCCAAAGAAGGAAGG - Intronic
1155109604 18:22700740-22700762 AATTGTTTGGCTAAGGTGGATGG + Intergenic
1156705599 18:39877798-39877820 AAGTTTGTGAATAATTTGGAAGG - Intergenic
1156885938 18:42136024-42136046 AAGTCTGTGAATGAGGAGGAGGG + Intergenic
1157676011 18:49569197-49569219 AAGTGTGGGGACAGGGTGGAGGG - Intronic
1165145285 19:33726558-33726580 AAGTGTGAGCATCAGCTGGGAGG + Intronic
1167116750 19:47493013-47493035 AAGTGTCTGCTGAAGGTGGCTGG - Exonic
1167133666 19:47603846-47603868 AGGTGTGTGTATGAGGTGGGTGG + Intergenic
1168363026 19:55759050-55759072 AAGGGTGTGGCTAAGGTGGGTGG + Exonic
1168363980 19:55769050-55769072 AAGGGTGTGGCTAAGGTGGGTGG + Intergenic
925762313 2:7197201-7197223 AAGTGAGTGAATAGGGTGCAAGG - Intergenic
926674466 2:15609054-15609076 AAGTGTGGGGATAGTGTGGAGGG + Intronic
927279649 2:21293052-21293074 AAATGTGTGAATCAGGTTGAGGG - Intergenic
927470864 2:23375487-23375509 AAGTGTATGGAGAAGGTGCAGGG + Intergenic
928095403 2:28401743-28401765 AGGTGTGTGCATATGAAGGAGGG - Intronic
929365395 2:41149603-41149625 GAGTGTGGGGAAAAGGTGGAAGG - Intergenic
931106006 2:59056471-59056493 AATGGTGTGCATGAGGTGGCTGG + Intergenic
933237271 2:79878987-79879009 TAGTTTTTGCATAAGGTGTAAGG + Intronic
934525824 2:95050903-95050925 AATTGTGTGAAGAAGATGGAGGG - Intronic
936017773 2:108972609-108972631 AAGTGTCTGCACAAGGGTGACGG + Intronic
938641027 2:133280280-133280302 AAATGGCTGCATAAGGGGGAAGG + Intronic
938750890 2:134328858-134328880 AAGTTTGAGCATAGTGTGGAAGG + Intronic
939047379 2:137265674-137265696 AAATGTGTGGAAAAGGTAGACGG - Intronic
939731523 2:145790510-145790532 ACGAGTGTTGATAAGGTGGATGG - Intergenic
940726076 2:157338022-157338044 AAGTCTGTGCAGAAGGAGCATGG - Intergenic
942232342 2:173872252-173872274 CTTTGTGTGCATAAGGTGCACGG + Intergenic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
1169057201 20:2633350-2633372 AACTGTGTGCATGATGTGTAAGG - Intronic
1169394977 20:5221100-5221122 AAGTGTGTGCTTGAGGTTGATGG - Intergenic
1169977935 20:11351870-11351892 ATGTGGGTGCATATGGTGGCCGG - Intergenic
1172446952 20:34998224-34998246 AAGTTTGTGCATCAGATGGCAGG - Intronic
1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG + Intergenic
1176326300 21:5504324-5504346 TAATGTTTGCATAAGGTGTAAGG + Intergenic
1176401457 21:6316627-6316649 TAATGTTTGCATAAGGTGTAAGG - Intergenic
1176435700 21:6672477-6672499 TAATGTTTGCATAAGGTGTAAGG + Intergenic
1176459962 21:6999547-6999569 TAATGTTTGCATAAGGTGTAAGG + Intergenic
1176483523 21:7381325-7381347 TAATGTTTGCATAAGGTGTAAGG + Intergenic
1181318816 22:21989096-21989118 AAGTGGGTGCAGCAGGAGGAAGG + Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183498057 22:38161690-38161712 AGGTGTGTGCATGGGGTAGAGGG + Intronic
1184770483 22:46594220-46594242 AAAGGTGTGCATAGGGTGGTGGG - Intronic
1184828135 22:46967054-46967076 AAGTGCGGGCATACGGTGGGAGG - Intronic
1185030547 22:48440776-48440798 TGGTGTGTGCCTCAGGTGGATGG - Intergenic
951172513 3:19558170-19558192 TAATGTGTGTATAAGGTGTAAGG + Intergenic
952159398 3:30678586-30678608 AACTGTGTGCAGAAGGATGATGG + Intronic
954509363 3:51108419-51108441 AAGTGTGTGTATGTGGTGGTTGG - Intronic
954532451 3:51332847-51332869 CAGTGTATGCCTAAGGTGGCTGG + Intronic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
957064377 3:75509419-75509441 AAGTTTTTGCTTAAGCTGGATGG + Intergenic
957211243 3:77261285-77261307 AAGTGTCTGCAGAACCTGGAAGG - Intronic
957403914 3:79752549-79752571 AGGTGTGTGCAGAGGGTGAAAGG + Intronic
957734664 3:84189918-84189940 AAGTATATGCATCAGGTGGGAGG + Intergenic
958811649 3:98866873-98866895 TAGTTTTTGCATAAGGTGTAAGG + Intronic
959092620 3:101920222-101920244 TAGTTTTTGCATAAGGTGTAAGG + Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
961288981 3:125829984-125830006 AAGTTTTTGCTTAAGCTGGATGG - Intergenic
961718349 3:128874612-128874634 AAGTGTGTCAACAGGGTGGAAGG + Intergenic
961747102 3:129071232-129071254 AGGTGGGTGAATAAGGAGGAAGG - Intergenic
961898108 3:130186065-130186087 AAGTTTTTGCTTAAGCTGGATGG + Intergenic
962364018 3:134765469-134765491 GAGTGAGTGAATAAGGGGGAAGG + Intronic
962384828 3:134924114-134924136 TAATTTCTGCATAAGGTGGAAGG - Intronic
962883281 3:139599372-139599394 AAAAGTGTGCATGAGGTGGTAGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966828620 3:183986987-183987009 AAGTATGTGCCTAAGATGCATGG - Intronic
967519294 3:190410235-190410257 AAGTGTGTGCATAAGGTGGAAGG - Exonic
969008234 4:4039153-4039175 AAGTTTTTGCTTAAGCTGGATGG + Intergenic
969745390 4:9066896-9066918 AAGTTTTTGCTGAAGGTGGATGG - Intergenic
969804691 4:9597884-9597906 AAGTTTTTGCTTAAGCTGGATGG - Intergenic
971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG + Intergenic
973751335 4:54023393-54023415 AAGTATATGCATCAGGTGGGAGG - Intronic
975191147 4:71464082-71464104 CAGTGTATGCATAAGATGAAAGG - Intronic
975530255 4:75392993-75393015 AAGTGTGTTGAAAAGATGGAGGG - Intergenic
975571987 4:75827282-75827304 AAATGTGTTCATAATGAGGAAGG + Intergenic
976360562 4:84173515-84173537 AAGAGTGTGCTTAAGGGGGAGGG + Intergenic
977096103 4:92746874-92746896 AAGTGTGTGCATAGGCCCGATGG - Intronic
980632782 4:135458177-135458199 AGATGTGTGCCTAAGGAGGAGGG + Intergenic
983953231 4:173666979-173667001 AAGTGTATCCATCAAGTGGAAGG - Intergenic
986384237 5:7216204-7216226 AAGAGTGGGCATGGGGTGGAGGG + Intergenic
994295365 5:98082816-98082838 AAGTATGTGCATCAGGTGGGAGG - Intergenic
995131027 5:108630670-108630692 GGGTGTGTGCGTAAGGTGGGTGG + Intergenic
996105778 5:119500811-119500833 AAGTGTGTCAAGAAGGAGGAGGG + Intronic
996676499 5:126181300-126181322 AATTGTATTCATAAGGTAGAAGG + Intergenic
996851638 5:127959604-127959626 AAGTGAGAGCATAAGGTAAACGG - Intergenic
997678583 5:135733486-135733508 AAGTATATGCATCAGGTGGGAGG + Intergenic
998053956 5:139057872-139057894 AAGTGTTTTCACATGGTGGAAGG + Intronic
998232399 5:140369188-140369210 TGGTGTGTGCCTAAGGTGGAAGG + Intronic
1000519182 5:162277365-162277387 AAGTATATGCATCAGGTGGGAGG + Intergenic
1003513458 6:6800380-6800402 ATGAGTGTGGATAGGGTGGAGGG - Intergenic
1003639547 6:7865073-7865095 TAGTGTGTGCATTGGGTGGGGGG - Intronic
1003794303 6:9582614-9582636 ATGTGTCTGCAAATGGTGGATGG + Intergenic
1006238006 6:32652694-32652716 AAGTGGAAGCATAAAGTGGAGGG + Intergenic
1006610400 6:35291197-35291219 GAGCCTGTGCATGAGGTGGACGG + Intronic
1008134961 6:47764174-47764196 AAGTGTTTGCATAAACTGCATGG + Intergenic
1008367558 6:50699938-50699960 GTGTGTGTGCATATGGTGGGGGG + Intergenic
1008982606 6:57502308-57502330 AAGGGTGAGCATCAGGTGGTTGG - Intronic
1009170677 6:60395171-60395193 AAGGGTGAGCATCAGGTGGTTGG - Intergenic
1011780816 6:90787377-90787399 AAATGTGTGCAGAGGGTAGAAGG + Intergenic
1015576152 6:134673204-134673226 AAACATGTGAATAAGGTGGAAGG + Intergenic
1016285385 6:142467021-142467043 AAGTGTGATGATAAGGTGGGTGG + Intergenic
1017794123 6:157825810-157825832 AGGAGTGTGCATATGGGGGAAGG - Intronic
1018448737 6:163884869-163884891 AAGAAAGTGAATAAGGTGGATGG + Intergenic
1018885920 6:167937106-167937128 GAGTGTGTACAGAAGGTGCAGGG + Intronic
1019395497 7:816075-816097 AGGTGTGTGCATCTGGGGGAGGG - Intergenic
1022094015 7:27127162-27127184 AAGTGTGTGTAGTAGGGGGAGGG + Intronic
1024305811 7:47928818-47928840 ATGTGTGTGCATGAGCTTGAAGG + Intronic
1028832178 7:95340313-95340335 AAGTGGGTGCAGAAATTGGATGG + Intergenic
1029745473 7:102513603-102513625 AAGTGTGTTTCTATGGTGGAGGG + Intronic
1029763412 7:102612582-102612604 AAGTGTGTTTCTATGGTGGAGGG + Intronic
1034858974 7:154580220-154580242 GTGTGTGTGTATAAGGGGGAGGG - Intronic
1035219880 7:157400191-157400213 AAGTGTGAGCATGAGGTGCTGGG + Intronic
1035943326 8:3929428-3929450 AAGTGGGTCCAAAAGCTGGAGGG + Intronic
1036249570 8:7150198-7150220 AAGTTTCTGCTTAAGCTGGATGG + Intergenic
1036367875 8:8136837-8136859 AAGTTTGTGCTTAAGCTGGATGG - Intergenic
1036883005 8:12528813-12528835 AAGTTTGTGCTTAAGCTGGATGG + Intergenic
1037641442 8:20747609-20747631 TAATGTTTGTATAAGGTGGAAGG - Intergenic
1038183768 8:25253417-25253439 ATGTGTGTGCATGGGATGGAAGG - Intronic
1038499164 8:28029186-28029208 AAGCGAGTGCAGAAGGTGGAAGG - Intronic
1038874433 8:31532510-31532532 AAATGTGTGCATGTGGGGGATGG + Intergenic
1039166484 8:34687054-34687076 AGCTGTGTGCATGAGGTGAATGG - Intergenic
1039278479 8:35956905-35956927 TAGTGTGTGCATACGCTGGGTGG + Intergenic
1041811905 8:61921183-61921205 ATGTGTGTGCAGGAGGTGTACGG - Intergenic
1047931987 8:129737636-129737658 TAATGTTTGTATAAGGTGGAAGG - Intergenic
1048517547 8:135124494-135124516 CAGTGTATGCAAAAGCTGGAAGG + Intergenic
1048617700 8:136095887-136095909 AAGTGTGGGCAGAAGGTCCATGG + Intergenic
1049632520 8:143666337-143666359 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1049632573 8:143666582-143666604 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1050625831 9:7502712-7502734 GAATGTGAGCATAAGGTGGGAGG - Intergenic
1051108689 9:13610208-13610230 AAGTGTGTGGTTTAGGGGGAGGG + Intergenic
1052344968 9:27400321-27400343 AAGTGGGTGCATTGGGTGAATGG - Intronic
1052653566 9:31330153-31330175 AAGTATATGCATCAGGTGGGAGG - Intergenic
1056044509 9:82702682-82702704 AAGTGTATGCATCAGGTATAAGG + Intergenic
1056191381 9:84187708-84187730 AAGTGTTTACTTATGGTGGAAGG + Intergenic
1058983724 9:110193146-110193168 AAGTTTGTGAAGAATGTGGAGGG + Intronic
1060896049 9:127218309-127218331 AGGTGTGTGCAGAGGGTGGGTGG - Intronic
1062604262 9:137337698-137337720 GAGTGTGTGCATATGTTGGGGGG + Intronic
1185975057 X:4710897-4710919 CCGTGTGTGCATTAGGAGGATGG + Intergenic
1186458659 X:9730874-9730896 AAATGTGGGCATATGGAGGAAGG - Intronic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187171781 X:16859273-16859295 AAGGGTGTTCATACTGTGGAGGG - Intronic
1188628553 X:32320002-32320024 AAGTATGTGTGTGAGGTGGAGGG - Intronic
1189239764 X:39516213-39516235 ACGTGTGTGTATATGGTGGTGGG - Intergenic
1189283120 X:39833094-39833116 AAGTGTGTGTATGTGGTGGTTGG - Intergenic
1190513806 X:51202276-51202298 AATTGAGTGTATAAGGTGTAAGG + Intergenic
1190627773 X:52353081-52353103 AAGTGTGTGCACCAGGAGAAAGG - Intergenic
1191193899 X:57700125-57700147 AAGTATGTGTATGTGGTGGAAGG - Intergenic
1193851368 X:86541819-86541841 GTGTGTGTGCATGAGGAGGAAGG + Intronic
1194786073 X:98085861-98085883 AAGTTTGGGGAAAAGGTGGAGGG + Intergenic
1195688205 X:107603855-107603877 GAGTGTGAGCCCAAGGTGGATGG - Exonic
1198063067 X:133066697-133066719 TAATTTTTGCATAAGGTGGAAGG - Intronic
1199535254 X:148895431-148895453 ATGTGTGTGTTTAAGGTGGTGGG - Intronic
1199659144 X:150029976-150029998 AAATGTCTACATAAGGTGTAAGG - Intergenic
1200651922 Y:5849691-5849713 AAGTGTGTGCTGAAGGTAAAGGG + Intergenic