ID: 967520762

View in Genome Browser
Species Human (GRCh38)
Location 3:190429644-190429666
Sequence CCTGTTCCTGCTCCATGTTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967520762_967520769 22 Left 967520762 3:190429644-190429666 CCAAAACATGGAGCAGGAACAGG 0: 1
1: 0
2: 0
3: 26
4: 243
Right 967520769 3:190429689-190429711 TGAAGGTGAATTCCAACAGTTGG 0: 1
1: 0
2: 0
3: 15
4: 209
967520762_967520768 5 Left 967520762 3:190429644-190429666 CCAAAACATGGAGCAGGAACAGG 0: 1
1: 0
2: 0
3: 26
4: 243
Right 967520768 3:190429672-190429694 GGTCAGGGGTTTGAGTTTGAAGG 0: 1
1: 0
2: 3
3: 11
4: 156
967520762_967520767 -9 Left 967520762 3:190429644-190429666 CCAAAACATGGAGCAGGAACAGG 0: 1
1: 0
2: 0
3: 26
4: 243
Right 967520767 3:190429658-190429680 AGGAACAGGATATAGGTCAGGGG 0: 1
1: 0
2: 2
3: 26
4: 313
967520762_967520766 -10 Left 967520762 3:190429644-190429666 CCAAAACATGGAGCAGGAACAGG 0: 1
1: 0
2: 0
3: 26
4: 243
Right 967520766 3:190429657-190429679 CAGGAACAGGATATAGGTCAGGG 0: 1
1: 0
2: 1
3: 19
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967520762 Original CRISPR CCTGTTCCTGCTCCATGTTT TGG (reversed) Exonic
900891735 1:5454588-5454610 CCTGTGCCTGCTGAATGGTTGGG - Intergenic
901878953 1:12182785-12182807 CCTGTTGCTCCTCCAGGTCTTGG - Intronic
902607098 1:17574843-17574865 CCTGTTCCAGCTCCATTGTGTGG + Intronic
903153679 1:21430162-21430184 CATGGTCCTGCTTCATGCTTTGG + Intergenic
903595500 1:24490737-24490759 CTTGTTACTGCTCACTGTTTGGG + Intergenic
904201070 1:28819374-28819396 GCTGTTCCTGCTGCATCTCTTGG + Intronic
904517153 1:31065447-31065469 GCTGTTCCTCGTACATGTTTTGG - Intronic
904914624 1:33960940-33960962 CCTTTTCCTGATCCCTGTGTGGG + Intronic
905105688 1:35562352-35562374 CCTGGTCCTGCTCCATCTCAAGG + Intronic
908743924 1:67356949-67356971 CCTGTTTCTGATTCATGTTTTGG - Intronic
911839087 1:102659317-102659339 CCTGCTGCTGCTCACTGTTTGGG - Intergenic
912640849 1:111344928-111344950 ACTGTTCCTTTTCTATGTTTAGG + Intergenic
912867873 1:113275231-113275253 CCAGTTCCTGCTCATTCTTTGGG - Intergenic
914904610 1:151733583-151733605 CCTGTTCCTGGTCTCTGTTGAGG - Intergenic
915706579 1:157849516-157849538 CCTGCCCCTGCTCCTTCTTTAGG + Intronic
916016246 1:160752291-160752313 TCTTTTCCTGCTTCATGTTTAGG + Intronic
917055037 1:170971751-170971773 AGTGTTGATGCTCCATGTTTGGG + Exonic
917151558 1:171950958-171950980 CCTCTTCCTCCTCCATTTTTTGG + Intronic
917540548 1:175909083-175909105 CCTGTTTATGATCCCTGTTTTGG + Intergenic
920150371 1:203901113-203901135 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
920711487 1:208299494-208299516 CCTTGTCCTGCTCCAAGGTTGGG + Intergenic
921398701 1:214696088-214696110 CATGTTCCTGCGCCACATTTTGG + Intergenic
921437576 1:215143612-215143634 CATGTGCCTGCTGCATGATTAGG - Intronic
921457887 1:215394332-215394354 CTTGTTGCTGCTCAGTGTTTGGG - Intergenic
922890569 1:229058694-229058716 CCTGTTCCTGCTCCAGGATGGGG - Intergenic
922943982 1:229494437-229494459 ACTGTTCTTGTTACATGTTTTGG - Intronic
923525677 1:234770723-234770745 CTCATTCCTGCTCCATGTCTGGG - Intergenic
924260980 1:242231231-242231253 CCTCTTCCTCCTCCCTGTTGAGG + Intronic
1063777475 10:9280574-9280596 CTTGGTCCTGCTTGATGTTTCGG + Intergenic
1065901409 10:30211327-30211349 CCTGTACCTGCGGCATGATTGGG + Intergenic
1066441422 10:35443029-35443051 ACTGTACCTTTTCCATGTTTAGG - Intronic
1067788056 10:49265767-49265789 CCTATTCTTTCTCCATTTTTGGG - Intergenic
1067792948 10:49301494-49301516 GCTCTACATGCTCCATGTTTGGG - Intronic
1070659706 10:78295754-78295776 CCTGCAGCAGCTCCATGTTTGGG - Intergenic
1071314768 10:84384231-84384253 CCTCCGCCTCCTCCATGTTTTGG - Intronic
1072708343 10:97698470-97698492 CCTGTTCCTACTCAAGGTGTGGG + Intergenic
1074196284 10:111188501-111188523 CTTGTTCCTGGTCCATTTTCTGG + Intergenic
1074928937 10:118103625-118103647 CTTGATAATGCTCCATGTTTTGG + Intergenic
1074966895 10:118498896-118498918 CCTGTTCCTTCTACTTGATTTGG - Intergenic
1075258418 10:120943487-120943509 CCTTTTCCAGCTCCATGTAGAGG - Intergenic
1075556390 10:123435517-123435539 GCTTTTCCTGCTGCATGTCTGGG + Intergenic
1075635655 10:124028746-124028768 CCAGTTACTGCTCCACGTATGGG + Intronic
1075761659 10:124862211-124862233 CCTGCTCCTGCTCCCAGTGTGGG - Intergenic
1075859299 10:125661231-125661253 CCTGTGTCTGCTCCATCTCTGGG - Intronic
1076231230 10:128821448-128821470 CATGTTCCTGCTCCACGGGTTGG - Intergenic
1076266452 10:129113029-129113051 CCTGTTCCTGTTCCTTGCTTGGG - Intergenic
1077603373 11:3589587-3589609 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
1080506227 11:32916690-32916712 ACTGTACCTTTTCCATGTTTAGG - Intronic
1083346582 11:61997628-61997650 TCTGTTCCTGCCCCTTGTTTAGG + Intergenic
1083484811 11:62976710-62976732 CCTCTTCCTCCTCCTTGTGTGGG + Exonic
1083875217 11:65519674-65519696 CCTCTTCCTCTTCCATTTTTTGG + Intergenic
1083898011 11:65629931-65629953 CCTGTGCCTGCCCCAACTTTAGG + Intronic
1084259271 11:67964132-67964154 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
1084592184 11:70097213-70097235 CCAGTCCCTGCCCCATGCTTGGG + Intronic
1084813502 11:71631049-71631071 CTTGTTGCTGCTCACTGTTTGGG - Intergenic
1084887721 11:72221884-72221906 TCTGTTGCTGCTCCATGGTGGGG + Exonic
1085321237 11:75575292-75575314 GCTATTACTGCTCCATGTTATGG + Intergenic
1086558212 11:88136851-88136873 CCTGTCCCTTCTCCATTCTTAGG + Intronic
1087749465 11:101990776-101990798 CCTGTTCTGCCCCCATGTTTTGG - Intronic
1088415531 11:109584778-109584800 CATCTGCCTTCTCCATGTTTGGG + Intergenic
1088554750 11:111050284-111050306 ACTGTACCTTTTCCATGTTTAGG - Intergenic
1088567864 11:111191930-111191952 CCTGTCTCTGTGCCATGTTTTGG + Intergenic
1089980739 11:122770127-122770149 ACTGTACCTGCTCCATGCATTGG - Intronic
1090128312 11:124113593-124113615 CTTGTTGCTTCTCCATTTTTAGG + Intergenic
1091533499 12:1383418-1383440 TCTGTTCCTGCTGCCTCTTTTGG + Intronic
1092009570 12:5098214-5098236 CTTCTTCCTGCTCCATGTGCTGG - Intergenic
1092362796 12:7851447-7851469 CCTTTCCCTGGTTCATGTTTGGG + Intronic
1093149694 12:15606337-15606359 CCAATTCCTGCTCCATTTCTGGG - Intergenic
1093829612 12:23739199-23739221 CCTTTTCCTCTTCCATGTTCTGG - Intronic
1094263739 12:28530436-28530458 CTTGTCTCTGCTCCATGTTTGGG - Intronic
1095953843 12:47795674-47795696 CCTCTTCCTGCCCCATGGCTTGG - Exonic
1096610272 12:52796324-52796346 CCTGGTGTTGCCCCATGTTTGGG + Intergenic
1101414763 12:104499438-104499460 CCAGTTGCTGCTCCAGGCTTAGG - Intronic
1102260565 12:111440746-111440768 CCTCTTCCTTTTCCATCTTTCGG - Intronic
1104939886 12:132390095-132390117 CCTGTGCCTGCACCAAGTTTTGG + Intergenic
1107150591 13:37106230-37106252 TCTGTTTCTTCTCCATATTTTGG - Intergenic
1108233882 13:48380976-48380998 CCTGTTCCTGATATAAGTTTAGG + Intronic
1109138873 13:58688197-58688219 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
1110569690 13:76990941-76990963 CCACTTGCTGCTCCAGGTTTGGG - Exonic
1110931727 13:81226900-81226922 CTTGTTGCTGCTCACTGTTTGGG - Intergenic
1111138644 13:84085736-84085758 CTTGTTGCTGCTCCCTCTTTGGG - Intergenic
1112637006 13:101226708-101226730 CCTGGTCATGCACCATGTCTAGG - Intronic
1113208856 13:107951204-107951226 CCTGTTGCTGCTCACTCTTTGGG - Intergenic
1113724284 13:112587154-112587176 CCATTTCTTGCTCCTTGTTTTGG - Intronic
1113812042 13:113148920-113148942 CCTCCTCCTGCTCCGTGTTCCGG - Exonic
1119650228 14:76377837-76377859 ACTGTTCCTGCTTCTAGTTTGGG + Intronic
1120964638 14:90156622-90156644 CCTGCTGCTCCTCCTTGTTTTGG - Intronic
1121476949 14:94217525-94217547 CCTGTTGTTGCTTTATGTTTTGG - Intronic
1122060901 14:99136135-99136157 CCTGTTGCTTCTCCATCTTCAGG - Intergenic
1127292350 15:57581826-57581848 CCTGTTCCTGATTGATGGTTGGG + Intergenic
1128757454 15:70192991-70193013 CTTGTTCCTGTTAAATGTTTAGG + Intergenic
1129186775 15:73912131-73912153 CCATTTCCTTCTCCTTGTTTGGG + Intergenic
1131992231 15:98103629-98103651 CCTGTTGCTGCTCGCTCTTTTGG - Intergenic
1135352995 16:21745747-21745769 CCTCTTCCTGATCCATGTCTTGG + Intronic
1135451481 16:22561870-22561892 CCTCTTCCTGATCCATGTCTTGG + Intergenic
1136642906 16:31581843-31581865 GCTGTACCTTCTCTATGTTTAGG + Intergenic
1136662722 16:31779295-31779317 GCTGTACCTCCTCTATGTTTAGG - Intronic
1137446680 16:48536337-48536359 CTTCTTCCTGCTGCCTGTTTTGG + Intergenic
1138316220 16:56072565-56072587 GCTGCTCCAGCACCATGTTTGGG + Intergenic
1140711398 16:77681285-77681307 CTTGTTCTTGCTCCATGGTTGGG + Intergenic
1141182863 16:81766243-81766265 CCTATGCCTCCCCCATGTTTTGG - Intronic
1141471897 16:84244384-84244406 CCTTTTCTTGCTCCATTTTGTGG - Intergenic
1144031240 17:11325186-11325208 CCTGCTCCTGCTCCACTTTTGGG - Intronic
1144524863 17:15980557-15980579 CCTGTTTCTGCTTCATGGTCTGG + Intronic
1151862059 17:76771636-76771658 CCTTGTCCTGCTCCAGGTGTTGG - Intronic
1152562505 17:81085596-81085618 CCTGTTCCGGGTCCATGTGTTGG + Intronic
1152737911 17:82006553-82006575 CCTGCTCCTCCTCCCTGTGTTGG + Intronic
1154029922 18:10744684-10744706 CCAGTTCCTGCTCCATCTGTGGG + Intronic
1154323473 18:13372741-13372763 CATGTTCATGCTCCATGTCCTGG + Intronic
1156708127 18:39908577-39908599 CCTGTGCCTGCACTATTTTTTGG + Intergenic
1157695858 18:49723082-49723104 CCAGTTCCGGCCCCATGGTTTGG - Intergenic
1159505845 18:69334056-69334078 CCTGTTCCTGCTTCACCTTCAGG + Intergenic
1160329016 18:77975499-77975521 CCTGCTCCTGCTCCATGGAGGGG + Intergenic
1161337344 19:3721705-3721727 CCTCTTCCTCCTCCAGGTCTCGG - Intronic
1161569472 19:5022650-5022672 GCTGTTCCTGCTCCACCTCTTGG + Intronic
1162512480 19:11127939-11127961 CCTCTGCCTGCTCCATTTCTTGG + Intronic
1164613032 19:29646092-29646114 CGTGTTCCTGCTCTATCTCTTGG - Intergenic
1164797609 19:31046692-31046714 CCCGTTCCTGCTCAATAATTAGG - Intergenic
1164913078 19:32027861-32027883 CCTGTTCCTTCTGCATTTTCAGG - Intergenic
1165313031 19:35040042-35040064 CCTGCTTCTGCTGCCTGTTTGGG + Intronic
1166368851 19:42290670-42290692 CCTCTTGCTCCTCCTTGTTTGGG - Exonic
926220815 2:10934530-10934552 CCTGTTCCTCCTCCAAGTGTTGG + Intergenic
926437499 2:12853137-12853159 CTTGTTGCTGCTCAATCTTTGGG - Intergenic
928334560 2:30385523-30385545 TCTGTGCCTGCTCCATGTCTGGG + Intergenic
928649094 2:33386247-33386269 CCTGTTCCTATGCAATGTTTAGG - Intronic
929001678 2:37353236-37353258 CCTGTTGCTGTTCATTGTTTAGG - Intronic
929553515 2:42909145-42909167 CCTGTTCCTGCACCAGCTGTGGG + Intergenic
931009353 2:57890567-57890589 TCTGTGCCTGATCCCTGTTTGGG - Intergenic
932494817 2:72141067-72141089 CTAGCTCCTTCTCCATGTTTTGG + Intronic
932885425 2:75545184-75545206 TCTTTTCCTGCTTCATATTTTGG - Intronic
934845977 2:97661551-97661573 ACTCTTCCTGCTCCGAGTTTAGG + Intronic
938063144 2:128267514-128267536 CATGGTCCTGCTTCATGCTTTGG - Exonic
939018590 2:136931467-136931489 GAGGTTCATGCTCCATGTTTGGG + Intronic
940179279 2:150914135-150914157 CCAGTTCCTGCTCCATGAACTGG - Intergenic
940506813 2:154566124-154566146 TCTGTTCTTGCTTCATGTTATGG + Intergenic
943819213 2:192298756-192298778 CCTCTTCCTGTCCCATCTTTAGG - Intergenic
944813629 2:203352883-203352905 ACTGTACCTTCTCTATGTTTAGG + Intronic
945626561 2:212214610-212214632 CCAGTTCTTGCTCTATGTTCTGG - Intronic
946428314 2:219611671-219611693 CCTGTTTCCGCTCCCTGTTGGGG - Exonic
947875067 2:233462372-233462394 CCAGTTCCTGCTCCATGTCCCGG - Exonic
948731446 2:239966316-239966338 CCTGCTCATCCTCCATGTCTGGG - Intronic
1170339144 20:15303853-15303875 CCTCTTCCTTCTCCATCTGTTGG + Intronic
1170987860 20:21274744-21274766 ACTGTTCCTGCTTCAGGTCTTGG - Intergenic
1173845130 20:46183333-46183355 CAGGGTCCTGCTCCAGGTTTTGG + Intronic
1174111367 20:48200244-48200266 CTTGGTCCTGCTCCTTGTCTGGG - Intergenic
1174179791 20:48667707-48667729 CCTGTTCATTCTTCACGTTTCGG - Intronic
1174399394 20:50267774-50267796 CCTACTCCAGCTCCCTGTTTGGG + Intergenic
1176183513 20:63765289-63765311 CCACTTCCTGCTCCAGGGTTTGG + Intronic
1177081870 21:16649668-16649690 TCTGTCCCTGCTCCACCTTTGGG - Intergenic
1177723173 21:24933755-24933777 ACTGTCCCTTTTCCATGTTTAGG + Intergenic
1178573365 21:33761901-33761923 CCTTTTCCTGGTTCCTGTTTAGG + Exonic
1181410469 22:22714873-22714895 CCTGCTCCTGCTCCATCCTACGG + Intergenic
1182780083 22:32860624-32860646 CTTGTCCCTGCTTCATGTTTGGG + Exonic
1182879301 22:33719838-33719860 ACTGTACCTTTTCCATGTTTAGG + Intronic
1183563323 22:38594178-38594200 CCTGTCTCTGCCCCACGTTTTGG + Intronic
1183621409 22:38974991-38975013 CCAGTGCCAGCTCCCTGTTTAGG - Intronic
1184196178 22:42930326-42930348 CCTGGTGCTGCTGCATGTTGTGG - Intronic
1184205278 22:42998446-42998468 CCTTTTCTTGCTCTGTGTTTTGG - Intronic
949949748 3:9219417-9219439 CCTGTTCCTGCCACATGTTATGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951862268 3:27266407-27266429 ACTGTTCCTGCACCATTTGTTGG + Intronic
952705826 3:36376977-36376999 CCTGCTCCTGGGCCAAGTTTTGG - Intergenic
953213480 3:40897006-40897028 CCTGCTCCTCCCCCACGTTTTGG - Intergenic
953214122 3:40901935-40901957 CCCCTTCCTCCTTCATGTTTAGG + Intergenic
953456059 3:43043195-43043217 CCTGTGACTGCTCCCAGTTTGGG + Intronic
954230436 3:49212798-49212820 CTTGCTCCTGCTCAATCTTTGGG - Intronic
954750821 3:52812660-52812682 CCTGTTCTTGCCCCAGGGTTAGG - Intergenic
956519521 3:70088305-70088327 CTAGTCCCTGCTCCATGGTTGGG - Intergenic
959832727 3:110883611-110883633 TCTGTTCCTGACCCATCTTTTGG + Intergenic
961910408 3:130310077-130310099 CCTGTTTCTGCTCCTTTTCTGGG - Intergenic
962117841 3:132530865-132530887 CTAGTTCTTGCTCCATATTTGGG + Intronic
962928107 3:140013400-140013422 CTTGTTCCGGCTCTTTGTTTTGG + Intronic
963423150 3:145087871-145087893 CCTGCTCCTGGTCCTTGATTTGG + Intergenic
963700335 3:148618149-148618171 CTTGTTGCTGCTCAATCTTTTGG + Intergenic
965751857 3:171983640-171983662 CCTGTTCCTGCTAATTTTTTTGG - Intergenic
967520762 3:190429644-190429666 CCTGTTCCTGCTCCATGTTTTGG - Exonic
967962173 3:194934439-194934461 ACTGTTCCTTTTCTATGTTTAGG + Intergenic
969017843 4:4116262-4116284 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
969536768 4:7761051-7761073 CTTGTTCCTGGGGCATGTTTTGG + Exonic
969736155 4:8992432-8992454 CTTGTTGCTGCTCACTGTTTGGG - Intergenic
970721256 4:18991866-18991888 AGTGGTCCTGCCCCATGTTTTGG + Intergenic
972426048 4:38934073-38934095 CCTCTTCCTTCTAAATGTTTAGG - Intronic
972793325 4:42393459-42393481 CCTCTTCCTGCCCTGTGTTTCGG - Intergenic
972981605 4:44710691-44710713 CCTATTCCTGCTCCAGTTTGAGG - Intronic
974442429 4:61937375-61937397 CATGTTCCTGCATCAGGTTTGGG + Intronic
974792586 4:66711552-66711574 CCTGCTGCTGCTCACTGTTTGGG - Intergenic
974926305 4:68302964-68302986 CCTGTCCCTCCACCTTGTTTAGG - Intergenic
975627628 4:76365401-76365423 GCTGCTCCAGCTCCATATTTAGG + Intronic
978170027 4:105658821-105658843 CCTCTTCCTGCTCACTTTTTAGG + Intronic
978238857 4:106492022-106492044 CCTGTTCCTCCTCCCTGGGTGGG - Intergenic
979829522 4:125282016-125282038 CCTGTTGCTGCTCACTCTTTGGG + Intergenic
983520860 4:168707529-168707551 CCTGTTTCTGCTCCATCTCTTGG - Intronic
985403469 4:189614685-189614707 CTTGCTGCTGCTCAATGTTTGGG - Intergenic
985487087 5:158033-158055 CCTGTTCCTGCCCCAGGGATTGG - Intronic
987467528 5:18290278-18290300 CCTGTTAGAGCTCCATATTTTGG + Intergenic
990510955 5:56488567-56488589 CCTGTTGCTGATCCCTGTTTGGG + Intergenic
991701603 5:69321608-69321630 ACTGTTCCTTTTCTATGTTTAGG - Intronic
994769647 5:103965792-103965814 CCTGTTGCTGCTCACTCTTTGGG - Intergenic
997368227 5:133339303-133339325 CCTATTCCTGCTCCCTATTCAGG - Intronic
997641074 5:135449369-135449391 TCTGTTCCTCCTCCAGGTCTTGG + Exonic
1000212225 5:159118428-159118450 ATTTTTCCTTCTCCATGTTTCGG - Intergenic
1001665937 5:173433820-173433842 CGTTTTCCTGCTCCGTGCTTTGG + Intergenic
1001695701 5:173668140-173668162 CCTGTTCATGCTCCAAGGTCTGG + Intergenic
1001942121 5:175748136-175748158 CCTGCTCGTGCTCCAGATTTTGG - Intergenic
1002331797 5:178447927-178447949 TCTGTTCATGCTCCAAGTTAAGG - Intronic
1002392025 5:178921619-178921641 CCTTTTCCTGCTCCATGAACCGG + Intronic
1002905517 6:1445744-1445766 CTTGTTCCCGCCCCAAGTTTGGG - Intergenic
1005201927 6:23356963-23356985 ACTATTCCTGCTCCATGATACGG + Intergenic
1005741838 6:28799102-28799124 CCTGTTCACACTCCCTGTTTGGG + Intergenic
1006461497 6:34161886-34161908 CCTCTTCCTTCTCCATATGTGGG - Intergenic
1006970199 6:38035992-38036014 CCTCTCCCAGCTCCATGTTATGG + Intronic
1008604219 6:53124340-53124362 CCTGTTGCTCCTTCATCTTTGGG - Intergenic
1010472604 6:76247140-76247162 TCTGTTCCTGCTTCCTATTTGGG - Intergenic
1012165972 6:95952699-95952721 ACTGTGCCTACTCCTTGTTTTGG + Intergenic
1012562549 6:100601125-100601147 CCTGTTCCTGATTCAAGATTTGG + Intronic
1013339501 6:109199565-109199587 CCTGTTTCTGTTGCATGTTGGGG - Intergenic
1013805936 6:113995996-113996018 CTTGGTCCTGCTCCATGCTTTGG + Intronic
1014289211 6:119539411-119539433 CTTCTTCCTGCTCCATGTAGTGG - Intergenic
1015289723 6:131524971-131524993 CTTGTTGCTGCTCACTGTTTGGG - Intergenic
1018462168 6:164008771-164008793 ACTCTTCCTGCTGCATCTTTTGG + Intergenic
1018657834 6:166056486-166056508 CCTGGTTCTGCTCCATGTACTGG + Intergenic
1021866841 7:24966574-24966596 CCTTTTTCTGAGCCATGTTTAGG + Intronic
1022185551 7:27964051-27964073 CCTCTTCCTCCAACATGTTTTGG + Intronic
1022335539 7:29418275-29418297 TCTGTTCCTGCTCCCTACTTGGG - Intronic
1023751064 7:43373080-43373102 TCTCTTCCTGCTCCAGGTTTGGG - Intronic
1023952078 7:44854396-44854418 ACTGTTCCTTTTCTATGTTTAGG - Intergenic
1024468927 7:49746507-49746529 ACTGTTCCTTCTCTATGTTTAGG - Intergenic
1024942761 7:54779552-54779574 TCTTTTCCTGCTCCCTGTTGGGG + Intergenic
1026453694 7:70552754-70552776 CCTGTTACTGCTTCAGATTTGGG - Intronic
1026472774 7:70708457-70708479 CCAGATCCTGTTCCATGGTTGGG - Intronic
1028279903 7:88910650-88910672 CATGTTCCTTCTCCACATTTAGG + Intronic
1029076279 7:97936790-97936812 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
1030896090 7:115061915-115061937 CATGTTTCTTCTCCAGGTTTGGG - Intergenic
1031236841 7:119188142-119188164 CCTGTGCATGCTCCAATTTTTGG - Intergenic
1031883804 7:127224902-127224924 CCTGTGCCTGGCCCATGTCTAGG + Intronic
1033119677 7:138656511-138656533 CTTTTTCCTGCTTCCTGTTTAGG - Exonic
1033285239 7:140035830-140035852 CCTCTTCCTCCTCCTTCTTTTGG - Intronic
1035464635 7:159066459-159066481 CCTGTTCCCGCACCATCTGTGGG + Intronic
1037404104 8:18523216-18523238 CCTGCTCCTGCTGCATCTCTGGG - Intergenic
1037680683 8:21095106-21095128 CCTGTTTTTGCCCCATGTCTCGG + Intergenic
1038422520 8:27442590-27442612 CAGGCTCCTGCTGCATGTTTGGG + Intronic
1042619988 8:70694217-70694239 CCTGTTCCTGCTCACTGGGTGGG - Intronic
1045250664 8:100481082-100481104 CCTGTTCCTGCGCAAGGTGTGGG + Intergenic
1048848661 8:138623449-138623471 CCTGTCCCTGCTCCACATTTTGG - Intronic
1049795069 8:144493470-144493492 GCTGTTCCTGGTCCATCTTGTGG + Intronic
1050742163 9:8834741-8834763 CATGTTCCAGCTCATTGTTTTGG - Intronic
1051164529 9:14247820-14247842 CCTGTTCCTGCTTTTAGTTTAGG - Intronic
1052373214 9:27689291-27689313 CCTCTACCTGCTTCATCTTTTGG + Intergenic
1052917209 9:33932520-33932542 CCTCTTCCTCCGCCATGCTTGGG - Intronic
1056376973 9:86024317-86024339 CCTTTTCCTGCTCTATACTTCGG - Intergenic
1056766015 9:89445124-89445146 CCTGTTCCAGCACCTTCTTTCGG - Intronic
1057558819 9:96111314-96111336 GCTGTTCCTGCTCCCTGCTCCGG - Intronic
1058055896 9:100448515-100448537 ACTGTTCCTTCTCCATGGTTGGG + Intronic
1060233204 9:121840891-121840913 CCAGTGCCTGATTCATGTTTGGG - Intronic
1061587810 9:131579827-131579849 CCTGTTTGTGCTCCATGTGCTGG - Intronic
1061692193 9:132342230-132342252 TCTGTTCCTGCTCACTGTTCTGG + Intronic
1189421368 X:40861079-40861101 CCTGTGGCTGCTCCAGGTTGAGG + Intergenic
1190713337 X:53084739-53084761 CCTGTACCTGCTCCAGGTGGGGG - Exonic
1193271214 X:79531582-79531604 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
1194076676 X:89402882-89402904 TCAGTTCCTGCTCCTTGTCTTGG - Intergenic
1196859610 X:120015024-120015046 CCTGCTCCTGCTCCCTGCTCGGG + Intergenic
1197143381 X:123141817-123141839 GCTGTTCCTGCACCATGATGAGG - Intergenic
1197979516 X:132200435-132200457 CCTGTTCCTACTTCATTCTTAGG - Intergenic
1199975751 X:152894097-152894119 CCTGTTGCGGCTCCCAGTTTGGG - Intergenic
1200218079 X:154377472-154377494 CCTCTTCATGCTCCCAGTTTGGG + Intergenic
1200429319 Y:3058410-3058432 TCAGTTCCTGCTCCTTGTCTTGG - Intergenic
1201395486 Y:13543338-13543360 CCTCCTCCTCCTCCATTTTTTGG - Intergenic
1201417400 Y:13761124-13761146 CCATTTCCTTTTCCATGTTTTGG + Intergenic
1201483955 Y:14471997-14472019 CCTATTCCTTATCCATCTTTTGG - Intergenic
1201973337 Y:19819149-19819171 CCTGTTCCTTCTCACTGATTGGG + Intergenic