ID: 967522302

View in Genome Browser
Species Human (GRCh38)
Location 3:190446968-190446990
Sequence CTGCTCTTTCAGCTTTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967522302_967522303 29 Left 967522302 3:190446968-190446990 CCATGCAAAAGCTGAAAGAGCAG 0: 1
1: 0
2: 1
3: 30
4: 256
Right 967522303 3:190447020-190447042 TAAGAAGATCCACCAGAAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967522302 Original CRISPR CTGCTCTTTCAGCTTTTGCA TGG (reversed) Intronic
900799515 1:4728625-4728647 CTGCTCTTTCTGCCTTTCCACGG - Intronic
901466412 1:9424413-9424435 CTGCAATGTCAGCTTTTGCGGGG + Intergenic
901748534 1:11390917-11390939 CTGCTCTTTCAACTTTTCTGAGG - Intergenic
901777881 1:11572949-11572971 CTGCTCTTTGGGCTTTTCAAGGG + Intergenic
902158523 1:14509908-14509930 ATGTTATTTCAGCTTTTGCATGG - Intergenic
904794025 1:33045329-33045351 CTGCCCTTTCAGCTTCTGCAGGG - Intronic
906317121 1:44793576-44793598 CTGAACTTTCAGCTTTTTCAAGG + Intergenic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
908172713 1:61523277-61523299 CTTCCATTTGAGCTTTTGCAGGG - Intergenic
908432705 1:64074299-64074321 TTTCTTTTTCAGCTTCTGCAAGG + Intronic
908968877 1:69800802-69800824 CTTGTCTTTCAGTTTTTACAGGG + Intronic
909755853 1:79224501-79224523 CTGCTTTTGCTGCTTTTGCCAGG - Intergenic
914348938 1:146823036-146823058 CTTGTCTTTCAGCTTTTCCGTGG + Intergenic
914463988 1:147909834-147909856 CTGGTCTTTCTGATTTTTCAAGG + Intergenic
915451316 1:156007323-156007345 CTGTTCTTTGAGCTCTGGCAGGG - Intergenic
917136420 1:171792239-171792261 CTGCTCTTGGAGCATTTGAAGGG + Intronic
917597844 1:176547556-176547578 TTGCTCTTAAAGTTTTTGCATGG - Intronic
921006762 1:211101191-211101213 CTGCTCTTACAGCATCTGTAGGG - Intronic
921381824 1:214532429-214532451 GTGGTCTTTCAGGCTTTGCATGG - Intronic
922210860 1:223485417-223485439 CTGAGATTTCATCTTTTGCATGG + Intergenic
922416413 1:225427268-225427290 CTGCTTTTTCACCTTTTTGAGGG - Intronic
924872135 1:248059785-248059807 CTGCACTCCCAGCATTTGCAAGG + Intronic
1063114427 10:3063964-3063986 CTGCTGTTTCTGCCTGTGCATGG - Intergenic
1064013371 10:11754315-11754337 CTGCTCTTTGAACCTTGGCAGGG - Intronic
1066276093 10:33870339-33870361 CTGCTTTTTCAGAATTTCCAGGG + Intergenic
1066562780 10:36688864-36688886 ATGCTCTCTCAGCTCTGGCATGG + Intergenic
1068605390 10:58999680-58999702 CTACTCGTTCAGTTTTAGCAAGG + Intergenic
1073653581 10:105387928-105387950 CAGCTCTTTTAGCTTTGGCATGG + Intergenic
1074191171 10:111139104-111139126 CTGCTCTTCCATGCTTTGCATGG - Intergenic
1075135470 10:119781623-119781645 CTCCTCTTTCAGATCTTCCATGG + Exonic
1075383450 10:122037641-122037663 ATGGTCTTTGAGCCTTTGCAGGG + Intronic
1078153536 11:8778843-8778865 CTGCCCTTTCATCTTTACCATGG - Intronic
1079042855 11:17074944-17074966 CTGCTCTTTGAGCTCTGGCCTGG - Intronic
1079541796 11:21585171-21585193 CTTCTCTTGCAGGTTTTCCAAGG - Intergenic
1080060368 11:27950297-27950319 CAGCTCTCTCAGTTTTTGTAGGG - Intergenic
1084274309 11:68043867-68043889 CTGCTGTTGCAGCTGCTGCAGGG - Exonic
1084410144 11:69002157-69002179 CTGCTCTTTTAGATTATGCAAGG - Intergenic
1084841246 11:71851283-71851305 CTACACTTTCTGCTTGTGCAGGG + Intergenic
1085331992 11:75660122-75660144 CTCCTCCTTCAACTTTTTCATGG + Intronic
1086014061 11:82143030-82143052 CTTGTCTTTCAGTTTTTGTAAGG + Intergenic
1086965564 11:93024356-93024378 CTGCACTTGAAGCTTTTGGATGG - Intergenic
1086982911 11:93218229-93218251 CTGCTATTTAAGCTTATGCTGGG + Intergenic
1089783340 11:120890284-120890306 CAGCTCATACAGCTTATGCATGG + Intronic
1090153862 11:124415022-124415044 ATGATCATTCAGCTTTTGCCTGG + Intergenic
1092112225 12:5971708-5971730 CTGTTTTTTCTGCTTTTCCAGGG - Exonic
1092125272 12:6071076-6071098 CTCCGCTTTCAGCTGTTGCAGGG + Intronic
1093814855 12:23533384-23533406 CTGGTATTTCAGGTTTTTCAAGG + Exonic
1094150060 12:27272864-27272886 ATGCTCTTTAACCTTTTGCCAGG + Intronic
1094679128 12:32652046-32652068 CTGCTCTTCCATCTTCTGCCTGG - Intergenic
1096743128 12:53709150-53709172 CAGATCTATCGGCTTTTGCATGG + Intronic
1097167132 12:57091838-57091860 CTTCTTATTCAGCTTTAGCAGGG - Exonic
1097382975 12:58917965-58917987 CTCCTCTTTCCACTTTTGAAAGG - Intronic
1097534544 12:60850110-60850132 CTGGTATTTCAGCTTTTGGATGG + Intergenic
1098560400 12:71865833-71865855 ATGCCCTTTCAGCTTTGGCCTGG + Intronic
1099595435 12:84656999-84657021 CAGCTCTTTCATCTCTTGAAAGG + Intergenic
1104098242 12:125581055-125581077 TTCCTCCTTCAGCTTTTTCATGG - Intronic
1105024052 12:132837021-132837043 CTCCTCATTCAGCTCCTGCAGGG - Intronic
1106832441 13:33599535-33599557 CTCCTCATTAAGCTTTTGGAAGG + Intergenic
1107823787 13:44309341-44309363 CTGTTCTTTCAGCATTTTCTGGG + Intergenic
1108468350 13:50741855-50741877 CTTTTCTTTCAGTTTTTGCATGG + Intronic
1108983048 13:56544649-56544671 TTGCTGTTTCAGCTTTTCAAGGG - Intergenic
1110130956 13:72009835-72009857 CTTTTCTGTTAGCTTTTGCATGG - Intergenic
1116594065 14:46818050-46818072 ATACTCTTTCAGCTATTGGAAGG - Intergenic
1116858850 14:49977794-49977816 CTGATCTCTCAGCTTTGCCAGGG - Intergenic
1118098498 14:62567537-62567559 CTGCTCTTCCAGCAGGTGCATGG - Intergenic
1118764875 14:68903214-68903236 CTATTCTTTCTGCTTTTGCCTGG + Intronic
1120848742 14:89149403-89149425 CTGCTCTGTCAGCTCCTCCATGG - Intronic
1123472663 15:20566515-20566537 CTTCTCTTTCAGCACTTGCTTGG + Intergenic
1123645343 15:22433838-22433860 CTTCTCTTTCAGCACTTGCTTGG - Intergenic
1123666606 15:22613479-22613501 CTTCTCTTTCAGCACTTGCTTGG - Intergenic
1123732968 15:23161506-23161528 CTTCTCTTTCAGCACTTGCTTGG + Intergenic
1123751098 15:23358883-23358905 CTTCTCTTTCAGCACTTGCTTGG + Intronic
1123760188 15:23425769-23425791 CTGCTAATTCAGTGTTTGCAGGG - Intergenic
1123926602 15:25118824-25118846 CTGCTTTTTCTCCTTTTGCTGGG - Intergenic
1124283473 15:28382801-28382823 CTTCTCTTTCAGCACTTGCTTGG + Intronic
1124299225 15:28528812-28528834 CTTCTCTTTCAGCACTTGCTTGG - Intronic
1124320449 15:28708052-28708074 CTTCTCTTTCAGCACTTGCTTGG - Intronic
1124482065 15:30087358-30087380 CTTCTCTTTCAGCACTTGCTTGG + Intronic
1124488523 15:30139458-30139480 CTTCTCTTTCAGCACTTGCTTGG + Intronic
1124521526 15:30409845-30409867 CTTCTCTTTCAGCACTTGCTTGG - Intronic
1124537135 15:30556374-30556396 CTTCTCTTTCAGCACTTGCTTGG + Intronic
1124543609 15:30608430-30608452 CTTCTCTTTCAGCACTTGCTTGG + Intronic
1124563561 15:30795879-30795901 CTTCTCTTTCAGCACTTGCTTGG + Intergenic
1124761514 15:32451217-32451239 CTTCTCTTTCAGCACTTGCTTGG - Intronic
1124777117 15:32597851-32597873 CTTCTCTTTCAGCACTTGCTTGG + Intronic
1125452825 15:39826730-39826752 CTGCTTCTTCAGCTCTTGCCTGG + Intronic
1125935857 15:43635059-43635081 CTCCTCTTTCATCTTTTATAAGG + Intronic
1126910743 15:53414801-53414823 CTTCTCTTCCACCTTTTACAAGG + Intergenic
1127773798 15:62250615-62250637 CTCCTCTTTCAGCATTTGCTTGG - Intergenic
1127774737 15:62255989-62256011 CTTCTCTTTCAGCATCTGCTCGG - Intergenic
1127775333 15:62260217-62260239 CTTCTCTTTCAGCACTTGCTTGG - Intergenic
1129029618 15:72608862-72608884 CTTCTCTTTCAGCACTTGCTTGG + Intergenic
1129037558 15:72659896-72659918 CTTCTCTTTCAGCATTTCCTTGG + Intronic
1129212329 15:74077329-74077351 CTTCTCTTTCAGCATTTCCTTGG - Intronic
1129398068 15:75263750-75263772 CTTCTCTTTCAGCATTTCCTTGG + Intronic
1129401679 15:75288031-75288053 CTTCTCTTTCAGCATTTCCTTGG + Intronic
1129475270 15:75780738-75780760 CTTCTCTTTCAGCATTTGCTTGG + Intergenic
1129839060 15:78732323-78732345 CTTCTCTTTCAGCACTTGCTTGG + Intergenic
1131720226 15:95160306-95160328 AGCCTCTTTCAGCTTTTTCAGGG - Intergenic
1132277999 15:100586322-100586344 CTGTTCTTTCAGTTTTAACAAGG - Intronic
1132362455 15:101228036-101228058 CTGCTTTTTCCGCCTTTGTATGG - Intronic
1132433317 15:101777816-101777838 CTTCTCTTTCAGCACTTGCTTGG - Intergenic
1132728126 16:1347537-1347559 CTCCTCCTTCAGCCTCTGCAGGG - Exonic
1134031633 16:10996666-10996688 CTTCTCTTCCAGCGTCTGCATGG + Intronic
1134547550 16:15122597-15122619 CTGCTCTTTCGGCTCCTGCTGGG - Intronic
1134614947 16:15643502-15643524 CAGCTCTTTCAGGCTTTGGAGGG + Exonic
1135607704 16:23837354-23837376 CACCTCCTTCTGCTTTTGCAGGG + Exonic
1137734030 16:50711127-50711149 CTGCTCTTCAACCTTCTGCAGGG + Exonic
1138526180 16:57608707-57608729 CTGATCCTTCAGTTTTTTCAAGG - Intergenic
1139985095 16:70892519-70892541 CTTGTCTTTCAGCTTTTCCGTGG - Exonic
1143214053 17:5210809-5210831 ATGCTTTTTCAGTATTTGCAGGG + Exonic
1143294806 17:5862941-5862963 CTCCTCTTTCATCTGTTTCATGG + Intronic
1144345912 17:14349550-14349572 CTGATCTTTCAGATTTTAAAGGG + Intergenic
1145095241 17:20019755-20019777 CTTCTCTTCCAGCTTTCCCACGG + Intronic
1146472296 17:33134338-33134360 CTGCTCTGTAAGCTTTTGGAGGG - Intronic
1146654130 17:34625383-34625405 CTGCTCTCTCAGCTGGTGTAGGG - Intronic
1146768503 17:35546451-35546473 CTGCTCTTCCACCTCTTGGAAGG + Intergenic
1147183437 17:38701312-38701334 CAGCTCTTACAGCATTTGCTGGG + Intergenic
1148743725 17:49907237-49907259 CTGCTCCCTCAGCTTCTGGAAGG - Intergenic
1151360861 17:73588037-73588059 CTGCTGTTTCAGCTGTTCCTGGG - Intronic
1152063092 17:78093773-78093795 CTGCTCTTCCTGCCTCTGCATGG + Intronic
1152757040 17:82091394-82091416 CTGCTCCAGCAGCTTCTGCACGG + Exonic
1157106621 18:44780144-44780166 CTGCTCCTCCAACTCTTGCAAGG + Intronic
1157117032 18:44871479-44871501 CTGTCCTCTCAGCTTTTGCATGG + Intronic
1157819496 18:50755078-50755100 CTGCTCCTGCAGCCTTTGCATGG + Intergenic
1159115909 18:64113107-64113129 CTGGTCTTTCCGTTCTTGCACGG + Intergenic
1159428427 18:68319965-68319987 CTGATCTTTCACCTTTTACTTGG - Intergenic
1161531945 19:4794981-4795003 CTGTTCTTTCAGCTGCTCCAAGG + Exonic
1163752723 19:19087768-19087790 CTGCTTATTCAGAGTTTGCAAGG + Intronic
1166242974 19:41506368-41506390 CGCTTCTTCCAGCTTTTGCAGGG - Intergenic
1167305827 19:48708754-48708776 CTCGTCTTTCAGCTTCTGCCAGG - Intergenic
1167840661 19:52115550-52115572 GTGACCGTTCAGCTTTTGCAAGG - Exonic
1168000516 19:53442080-53442102 CGCTTCTTCCAGCTTTTGCAGGG - Intronic
1168005012 19:53479564-53479586 CGCTTCTTCCAGCTTTTGCAGGG - Intronic
1168073749 19:53967256-53967278 CTGCTGTTTCATCTTATGAATGG - Intronic
926789878 2:16559585-16559607 CTGCTGTTTCTTCTCTTGCAGGG - Exonic
927118591 2:19929465-19929487 CTGGTCTTTCAGCTTGGCCATGG - Intronic
927976610 2:27343248-27343270 CTGCTCTTTCATCTTAAGCTTGG + Intronic
930737357 2:54793277-54793299 TTGATCTTTCAGCGTTTGCAGGG + Intronic
931473438 2:62563816-62563838 CTTCACTTTCTGCTCTTGCAAGG - Intergenic
931663522 2:64592578-64592600 TTGCTGTTTGACCTTTTGCAAGG + Exonic
933333432 2:80923795-80923817 CTGCTCTTTCAGGCATTGTAGGG - Intergenic
933460254 2:82574119-82574141 CTGCTCTAACATCTTTTGCAGGG + Intergenic
936984311 2:118294201-118294223 CTTGTCTTTCAGCTCTGGCAAGG - Intergenic
941124572 2:161570300-161570322 CTGGGCTTTCAGCTCTTCCAAGG - Intronic
941707348 2:168673700-168673722 CTGCTTTTTCAGTAATTGCAGGG + Intronic
942822599 2:180133452-180133474 CTTCCATCTCAGCTTTTGCATGG - Intergenic
944380318 2:199101684-199101706 CTGCTCTATAAGCTTTTGAAAGG + Intergenic
944855914 2:203766547-203766569 CTGATATTTCAGAATTTGCATGG + Intergenic
946093180 2:217248633-217248655 CTGCTATGCCAGCATTTGCAGGG + Intergenic
946148217 2:217746919-217746941 CTGCTCTCTCAGATATTGCAGGG + Intronic
947359790 2:229335287-229335309 CTGTTCTCTCAGATTCTGCAGGG - Intergenic
947488448 2:230573672-230573694 CGCTTCTTCCAGCTTTTGCAAGG + Intergenic
948007745 2:234624300-234624322 CTGCTCCTTCAGAATTTGCAGGG - Intergenic
948257100 2:236576448-236576470 CTCCACTTTCAGATTTTGCAGGG + Intronic
1172036960 20:32017971-32017993 CAGCTCCTTCAGCTGCTGCAGGG - Exonic
1175787173 20:61718976-61718998 GTGCTCTTTCATCTGGTGCAGGG - Exonic
1176202506 20:63868521-63868543 CTGCTCATTCAGCTCCTTCAGGG - Intronic
1177849026 21:26324580-26324602 CTGGTTTTTCAGCTTTTGGCTGG + Intergenic
1178351825 21:31877072-31877094 GCCCTCTTTCAGCTTTTTCATGG - Intronic
1181471080 22:23140319-23140341 CTCCTCCTTCAGCTTGGGCAGGG + Exonic
1182654105 22:31876152-31876174 CTGCTCTTCCAGCATTTTCTAGG - Exonic
1183941735 22:41299644-41299666 CTGCTATTTCAGCTTTAACATGG + Intergenic
1184838475 22:47038277-47038299 CTGCACGTTCAGGATTTGCAGGG + Intronic
1185313150 22:50167794-50167816 ATGCACTTTCTGCTTTCGCATGG - Intergenic
949402079 3:3675799-3675821 CTGCTCTTTCACATTTTCAAGGG - Intergenic
950812778 3:15665581-15665603 TTGCTGTTTCAACTTTTCCATGG - Intergenic
951337422 3:21441741-21441763 CTACTTTCTCATCTTTTGCAGGG - Intronic
952852968 3:37744229-37744251 CTGCTTTTTCAGGATTTGGAAGG + Intronic
953042824 3:39269863-39269885 CTGCTCTTTCCTCTGTAGCATGG - Intronic
955672765 3:61419123-61419145 CTGCTCTTTCCGTTTATGCACGG + Intergenic
956236332 3:67075857-67075879 TTGATCTTTCAGCTGTTTCATGG - Intergenic
956406594 3:68934099-68934121 ATGCTATTTCAGGTTTTGCTTGG - Intergenic
957321729 3:78639792-78639814 CTGCTCCATCAGCTGCTGCACGG - Exonic
958833706 3:99119198-99119220 ATGCTCTTTCTCCTTTAGCACGG + Intergenic
960956790 3:123037932-123037954 CTACTTTTTCATCTTTTGAAGGG - Intergenic
962735457 3:138321598-138321620 ATGCTCTTTCAGCTGCTCCAGGG + Intronic
962837186 3:139199799-139199821 CTGCTACTGCAACTTTTGCAGGG - Intronic
962915920 3:139903270-139903292 CTGAGCTTTCAGCTTCTGGAGGG + Intergenic
963071392 3:141308287-141308309 CTTCTCATTCAGCTTCTCCAGGG - Intergenic
963570125 3:146983256-146983278 CTGTACTTTCAACTTTTTCATGG + Intergenic
964893450 3:161564754-161564776 CTACTCTTTTAGCTTTTTGAAGG - Intergenic
965165566 3:165191761-165191783 CTGCTCTTCCAGCTTTTTACAGG - Intronic
967166538 3:186784310-186784332 CTGCTGCTTTAGCTTGTGCAGGG + Intronic
967522302 3:190446968-190446990 CTGCTCTTTCAGCTTTTGCATGG - Intronic
967552730 3:190817301-190817323 CTGCTATTTCTGCCTTTGAAGGG + Intergenic
969255453 4:5998747-5998769 CTCCTCTATAAGCTTTTGGAGGG + Intergenic
971773534 4:30930318-30930340 CTGCTCTTTCCACTTTTCCAAGG - Intronic
973898726 4:55444738-55444760 TTGGTCTTTCAGATGTTGCATGG + Exonic
974625204 4:64417200-64417222 CTCCCTTTTCTGCTTTTGCAAGG - Intergenic
976114492 4:81712480-81712502 CTCCTCTCTTGGCTTTTGCATGG - Intronic
980682462 4:136181071-136181093 CTGTTATTTCAGATTTTACATGG - Intergenic
983357744 4:166685506-166685528 CTGCTCTTTGAGCCTTTCCCAGG + Intergenic
984527305 4:180872878-180872900 GTGCTCTTTCAGTTTTTGGTAGG + Intergenic
985173364 4:187175470-187175492 CTCGTCTTTCAGCCTCTGCAAGG - Intergenic
985815019 5:2121164-2121186 CTTATCTTTCATCTTTTTCATGG + Intergenic
985850260 5:2383440-2383462 CCGCTCTTCCAGATGTTGCAGGG + Intergenic
986173206 5:5330556-5330578 CAGCTCTTTCTGCTTGAGCAGGG + Intergenic
986516264 5:8567008-8567030 CTGCTGTTTCAGCTTATACATGG + Intergenic
987313401 5:16701629-16701651 CCGCTCCTGCAGCTTCTGCAGGG + Exonic
988823311 5:34909767-34909789 CTGCTCTTAAGGCTATTGCATGG + Intronic
990466777 5:56078388-56078410 ATGCTCTCTCATCTTTTGCTTGG + Intergenic
990784946 5:59408663-59408685 CTGCCTCTACAGCTTTTGCAAGG - Intronic
991198007 5:63959172-63959194 TTGCTCTTTCAGGTTTTACTGGG + Intergenic
991493428 5:67205451-67205473 GTTCTCTTTCAGCTCCTGCATGG + Intergenic
992484171 5:77180014-77180036 CTGATCTTTCAGCGTTTTCCTGG + Intergenic
993091546 5:83432841-83432863 CTTCTCTTAGAGCTTTTGGAAGG + Intergenic
994666907 5:102716174-102716196 CTTAGTTTTCAGCTTTTGCAGGG - Intergenic
995502139 5:112819095-112819117 CTCCTCATCCAGCTTTTACATGG + Exonic
997795074 5:136800921-136800943 CAGCTCTTAAAGCTTTTGCCTGG - Intergenic
998692189 5:144599021-144599043 CTCCGCTTCCAGCTGTTGCAGGG + Intergenic
999395115 5:151222377-151222399 CTCCTCTTCCAGCTTGTGGAAGG + Intronic
1000592385 5:163173953-163173975 CTGTTCACTCAGCTATTGCAGGG - Intergenic
1000643681 5:163735619-163735641 CTGCTACTGCAGTTTTTGCATGG + Intergenic
1001583397 5:172816058-172816080 CTGCTCTTTAGGCTGTTGAAAGG - Intergenic
1001958307 5:175863591-175863613 CTGCCCTTTAAGCTTTTCCCTGG + Intronic
1002201486 5:177531282-177531304 CTTCTTTTTCAGCTTGTGCCGGG + Intronic
1002566600 5:180115758-180115780 CTGCTGTGTGAGCTTATGCAAGG - Intronic
1003644400 6:7902667-7902689 CTGTTCTTGGAGCTTCTGCAGGG + Intronic
1008705555 6:54154355-54154377 CTGTTCTATAAGCTTTTCCATGG - Intronic
1009910523 6:69920094-69920116 CTACTTTCTCAGTTTTTGCAAGG - Intronic
1010890208 6:81298444-81298466 GTGCTATTTCAGGTTTTGTAAGG - Intergenic
1014231911 6:118913420-118913442 CTGATCTTTCTGCTTTTCCTAGG - Exonic
1014709727 6:124792738-124792760 ATGCTTTTTCACCTTTTGCCTGG - Intronic
1015272754 6:131354157-131354179 CAGCTCTTTCACCTCTTGGATGG - Intergenic
1015385199 6:132614785-132614807 CTGCTCTTTTAACTTTCTCAAGG + Intergenic
1015867805 6:137745037-137745059 CTGCACTTTCAGCCGCTGCATGG + Intergenic
1017261509 6:152392996-152393018 CTGCTCATTCAGGTTCTCCACGG - Intronic
1017267229 6:152461606-152461628 CTGCTCTTTGAGCTTTGACATGG + Exonic
1017496855 6:154991153-154991175 CTGCTCTTTTTGTCTTTGCAAGG + Intronic
1018835438 6:167480013-167480035 CTGCTCTTTCAGCATTCACAGGG - Intergenic
1019668380 7:2264271-2264293 GTGACCTTTCAGCTTCTGCAGGG - Intronic
1019782424 7:2951293-2951315 CTTCTTTTTCTACTTTTGCAAGG + Intronic
1021157709 7:17232113-17232135 CTGCTCTAACAGCTTTGGCCAGG + Intergenic
1022081230 7:27023953-27023975 CTCTTCTTCCAGCTTTTGCAGGG - Intergenic
1022095210 7:27136420-27136442 CTTTTCTTTCACTTTTTGCAAGG - Intronic
1024210002 7:47194888-47194910 CTGCCCGTTCAGCTCCTGCATGG - Intergenic
1030437432 7:109541561-109541583 CTGGGCCTTCATCTTTTGCAGGG + Intergenic
1030562457 7:111106719-111106741 CTGCCCTTACAGATCTTGCAGGG + Intronic
1031053835 7:116972672-116972694 CGCTTCTTCCAGCTTTTGCAGGG + Intronic
1031323266 7:120360233-120360255 GTGCTCTTATAGGTTTTGCAGGG + Intronic
1033461448 7:141550864-141550886 CAGGCTTTTCAGCTTTTGCACGG + Intergenic
1034840071 7:154387465-154387487 CTGCTCTTTCAGCCTTGGCTTGG - Intronic
1034890537 7:154835317-154835339 CAGCTCTTTCAGCTTCTGGTGGG - Intronic
1035720444 8:1787429-1787451 CTGCTGTTTCATTTGTTGCAAGG + Intergenic
1036858569 8:12323375-12323397 CTACACTTTCTGCTTGTGCAGGG - Intergenic
1037141144 8:15521848-15521870 CTGCTCTTTAAGGTTGTACATGG + Intronic
1037529750 8:19761133-19761155 CTGTTCTTTCAGCTACTGAATGG - Intergenic
1037691598 8:21185683-21185705 CTCCTCTTTTAGCTCCTGCAGGG - Intergenic
1038196944 8:25377363-25377385 CTTCTCTTTAAGCTCTTGCTGGG - Exonic
1039003945 8:33012739-33012761 CTGCTCTTTCAGCTGTTCTTGGG - Intergenic
1042132776 8:65605066-65605088 CTGCTCTTGCTGATTTTACATGG - Intronic
1043162549 8:76863700-76863722 TTGCTTTTGCTGCTTTTGCAGGG - Exonic
1043215687 8:77584333-77584355 ATGGGCTTTCAGCTTGTGCAGGG + Intergenic
1043768271 8:84164365-84164387 CACTTCTTCCAGCTTTTGCAGGG + Intergenic
1045413621 8:101944645-101944667 CTGCTCTTTCATCTCCTGCATGG - Intronic
1047005309 8:120614033-120614055 CTGCTCTTTCTGTTTTTTCTTGG - Intronic
1047350430 8:124068400-124068422 CCTCTCTTTCATCATTTGCAAGG - Intronic
1049393646 8:142385377-142385399 CTCCTCTGTCAGCTTTTGATTGG - Intronic
1049823203 8:144649038-144649060 CTGCTCATTGATCTTTTGAATGG - Intergenic
1050022430 9:1298546-1298568 AGGCTGTTTCAGCTTTTACAGGG + Intergenic
1050972074 9:11890655-11890677 GTGCTCTTTCAGCCTTTTCGAGG + Intergenic
1051019333 9:12522593-12522615 TTTTTCTTTCAGCTTTTACATGG - Intergenic
1051630240 9:19134164-19134186 CTGGTCTTTCAGCTTTTCTGTGG + Intronic
1052010705 9:23405399-23405421 CTTCTGTTTCTGCTTTTTCAAGG - Intergenic
1052388866 9:27855189-27855211 CTTCTTCTTCATCTTTTGCATGG + Intergenic
1053220748 9:36310952-36310974 CTGCTATTTCTGCTATTGCTGGG + Intergenic
1055302956 9:74901222-74901244 CTGCTTTTTCAGCATTTCCCTGG - Intergenic
1055430025 9:76233805-76233827 CTGCTTTCTCATCTTTTCCAGGG - Intronic
1057594779 9:96406281-96406303 CTGATGTTTAAGCTTTTGGAAGG - Intronic
1058116690 9:101092569-101092591 CTGGCCTTTCAGCATTTCCAGGG + Intronic
1058685937 9:107479697-107479719 TTGCTCTTTAAGCTTTTAAATGG + Intergenic
1058790918 9:108444658-108444680 GTGCTGTTACAGCTTTGGCAGGG + Intergenic
1059292163 9:113235819-113235841 TTGCTGTTTCTGCTTTGGCAAGG + Intronic
1059576225 9:115491714-115491736 CAGCTCTTCCAGGTTTTGCCAGG + Intergenic
1059856426 9:118403228-118403250 CTGCTCTGACAGCTTATGCAGGG - Intergenic
1059923817 9:119186500-119186522 CTGCTCTGCCAGCTTGGGCATGG - Intronic
1186489606 X:9961214-9961236 TTGCTCTGTCAGCCTTTGGAGGG - Intergenic
1189235738 X:39485730-39485752 CTGGTTTTTAATCTTTTGCATGG + Intergenic
1189863820 X:45301888-45301910 TTGCTCTTTCAGTTTGTGCTTGG - Intergenic
1190897695 X:54637545-54637567 CTGGTCTGTCATCTTGTGCAAGG + Intergenic
1192969464 X:76216607-76216629 CTGCTCTTTCAGTTTTTTTAAGG + Intergenic
1196800642 X:119540351-119540373 CTGGTCTTTCTGCCTTTGAAAGG + Intronic
1198985560 X:142448637-142448659 CTCCTCTTTCTTCTTCTGCAGGG - Intergenic
1199600006 X:149536212-149536234 TTGTTCTTACATCTTTTGCAGGG - Intergenic
1200287508 X:154837742-154837764 TTCCTCTTTCAGGTTTTTCAGGG - Exonic
1201739503 Y:17308308-17308330 CTACTCTTTCACCTTTGTCATGG - Intergenic
1201895250 Y:18985899-18985921 CTGCACTGTCAGCTTTGGAAGGG - Intergenic