ID: 967527911

View in Genome Browser
Species Human (GRCh38)
Location 3:190515030-190515052
Sequence TTTCACAACCAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967527911_967527916 -10 Left 967527911 3:190515030-190515052 CCCTCCACCTTCTGGTTGTGAAA 0: 1
1: 0
2: 1
3: 21
4: 203
Right 967527916 3:190515043-190515065 GGTTGTGAAATTGTGAACCAGGG 0: 1
1: 0
2: 0
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967527911 Original CRISPR TTTCACAACCAGAAGGTGGA GGG (reversed) Intronic
900921626 1:5675467-5675489 TTCCACAACAAGAAGGTAAAGGG - Intergenic
900981398 1:6048107-6048129 CTTCACAACAAGATGGTGGAAGG - Intronic
901165444 1:7218285-7218307 AATCCCAACCATAAGGTGGAGGG - Intronic
902767724 1:18628429-18628451 TTTCACATCCAGCAGGGGAAAGG - Intergenic
903500572 1:23798111-23798133 TCTCACCTCCAGAAGCTGGATGG + Exonic
904014226 1:27407778-27407800 TTTTAGAACCAGAAGGTGGCTGG + Exonic
904977004 1:34464382-34464404 ATGCACAACCAGGAGGTGCAGGG + Intergenic
908947987 1:69523168-69523190 TTTCACTACTATAAAGTGGAGGG - Intergenic
911435209 1:97846954-97846976 ATTCAAAACCATAAAGTGGAGGG + Intronic
911501297 1:98688462-98688484 TTTCACAAAGAGGAAGTGGAAGG - Intronic
912347577 1:108978808-108978830 TTTGACAACCAGAAGTTTGTTGG + Intronic
913658077 1:120980566-120980588 TTTTAGAACCATAAGGTGGCTGG + Intergenic
914009431 1:143763635-143763657 TTTTAGAACCATAAGGTGGCTGG + Intergenic
914912969 1:151801709-151801731 TGCCACATCCAGGAGGTGGAAGG + Exonic
917429738 1:174953665-174953687 TTTCATAACCAGCAGTTTGAAGG - Intronic
917862337 1:179158497-179158519 TATCACAACCAGAAAGTTTAAGG + Intronic
918830635 1:189392824-189392846 GTGAACTACCAGAAGGTGGAGGG + Intergenic
919812649 1:201418957-201418979 TTTGCCTATCAGAAGGTGGAGGG + Intronic
921043048 1:211452662-211452684 TTAAAGAACCAGAAGGTGGCAGG + Intergenic
922192370 1:223330887-223330909 TATCAGAACTAGAAGATGGAAGG + Intronic
922345520 1:224693207-224693229 TTGCTGAACCAGAAGTTGGAGGG + Intronic
923050778 1:230390000-230390022 TCACACAGCCAGAAGGTGGGAGG + Intronic
923448181 1:234092059-234092081 TTTCACTTCCAGGAGCTGGAAGG + Intronic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
1062911167 10:1213412-1213434 TACCAGAACCAGAAGGTGGCTGG + Intronic
1069949424 10:72008808-72008830 TTTAACAATCAGAAGGGGCAAGG + Exonic
1071687366 10:87774065-87774087 TTTCACAAACATAATGTAGAAGG + Intronic
1071988367 10:91075278-91075300 TGGCAGAACTAGAAGGTGGAAGG + Intergenic
1072064814 10:91856946-91856968 TTTCTGAATCAGAAGGTCGAGGG + Intronic
1072223066 10:93344007-93344029 TTTAACAGCCATAGGGTGGATGG + Intronic
1072475045 10:95751825-95751847 CTTGACACCCAGTAGGTGGATGG + Intronic
1072933765 10:99692314-99692336 TGTCACAACTGGAAGGGGGAGGG - Intronic
1075159349 10:120009737-120009759 TTCCACAACCAGAAAGTGTAGGG - Intergenic
1076199180 10:128544848-128544870 TTTCACAATGTGGAGGTGGAGGG + Intergenic
1076809932 10:132881229-132881251 TTTCACAAGCAGAGGTGGGAAGG + Intronic
1078413515 11:11147222-11147244 TTTCACAACTGGAATGGGGAGGG - Intergenic
1078584309 11:12568208-12568230 TTTCACAAACTGAAGGTTCATGG - Intergenic
1079114266 11:17630988-17631010 TGGCAGAACCAGAAGATGGAAGG - Intronic
1080842355 11:35996571-35996593 TTTCACAAACTGAAGGTCTATGG - Intronic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1081147509 11:39581207-39581229 TATCACAAACAGAATGTGCAAGG - Intergenic
1083708292 11:64531529-64531551 TCACACAGCCAGAAGGTGGTTGG - Intergenic
1083958097 11:65997966-65997988 TATCACTTCCAGAAGGTGGCTGG - Exonic
1084320356 11:68370130-68370152 TTTCCCAACCAGAAGAGGCAGGG + Intronic
1084787211 11:71449228-71449250 TTTCAAAACAAAAAGGTGCAGGG - Intronic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1090420700 11:126573102-126573124 TTTTCCACCCAGAATGTGGAGGG - Intronic
1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG + Intergenic
1095359435 12:41318726-41318748 TTTCTCAAACAGAAGTGGGAAGG - Intronic
1099252402 12:80272551-80272573 TTTCATTACCAGAAGAGGGAGGG - Intronic
1103980677 12:124735007-124735029 TCACAGAACCAGAAGATGGAAGG + Intergenic
1104134001 12:125920140-125920162 TTTAAACACCAGAATGTGGAAGG - Intergenic
1106694884 13:32162706-32162728 ATTGGCAGCCAGAAGGTGGAAGG - Intronic
1107215786 13:37916900-37916922 TTTCACAAACGGGAGCTGGATGG + Intergenic
1107380854 13:39855284-39855306 TGTCAAAACCACAAAGTGGAGGG - Intergenic
1107757729 13:43643250-43643272 ATTCACAGCCAGGAGGTAGACGG - Intronic
1108005786 13:45944921-45944943 TTTCACAAGCAGACTTTGGAGGG - Intergenic
1108934816 13:55870947-55870969 TTTGCCAACCTGAAGGTGGTGGG - Intergenic
1109498537 13:63208447-63208469 TGTCACAGCAAGAAGGTGCAAGG - Intergenic
1109574960 13:64243281-64243303 TTTCACAACCAGAGGAAGGAAGG - Intergenic
1110797941 13:79661423-79661445 TTTCACACCCAGGCTGTGGAGGG + Intergenic
1110911213 13:80966412-80966434 TTTCAGGAGCAGAAGTTGGATGG + Intergenic
1111903131 13:94224556-94224578 AATCAGAACCATAAGGTGGATGG + Intronic
1114444261 14:22776163-22776185 TTTCACTAGCAGAAGGTTGAGGG - Intronic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1115409778 14:33060985-33061007 ATTCACAACCAAAAGAGGGAAGG + Intronic
1116270365 14:42757061-42757083 TGACACAAACACAAGGTGGAAGG - Intergenic
1116936434 14:50745281-50745303 TTTCACAACTGGAAGGTGGGGGG - Intronic
1117951732 14:61089650-61089672 TTTCTCAATCAGTAGGTGGAAGG + Intergenic
1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG + Intronic
1118535013 14:66752768-66752790 TTTCACAACCTGAAGGTTTCTGG - Intronic
1119974507 14:79010519-79010541 TTTCACAACCCAAAAGAGGAGGG + Intronic
1121673883 14:95736416-95736438 ATTCACAAACATAAGGTTGAGGG + Intergenic
1122042770 14:99000896-99000918 TTTCACCAACAGAAGGGAGATGG + Intergenic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1131024995 15:89133170-89133192 TTTCACAAAGAAAAGATGGAAGG - Intronic
1131720022 15:95157763-95157785 ATTCACAGCCAGAAGTTGAATGG - Intergenic
1131959815 15:97777526-97777548 TTCCAAAACCATAAGGAGGAGGG + Intergenic
1136566581 16:31073973-31073995 TTCAAGAACCAGAAGGTGGGAGG + Intronic
1137593027 16:49705424-49705446 TTGCAGAACAAGAATGTGGATGG + Intronic
1138113578 16:54342882-54342904 TTTCACACCCAGAAGGCAGCAGG - Intergenic
1138880221 16:61004488-61004510 TTTCACAAAGAGAAAATGGAGGG + Intergenic
1138999479 16:62492180-62492202 TTAAACAAACAGATGGTGGATGG + Intergenic
1140744055 16:77965512-77965534 TTTCCCATCCAGACAGTGGAGGG - Intronic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1142947109 17:3439181-3439203 ATACACAACCAGAAAGTGCAAGG + Intergenic
1143232781 17:5371508-5371530 TTTCATATCCAGAAGGTGGTGGG + Intronic
1144669489 17:17124972-17124994 CTCCCCAACCAGAAGGTGGCAGG + Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1150316369 17:64172479-64172501 ATGCCCAACCAGAAGCTGGAGGG - Intronic
1150664840 17:67123880-67123902 TTTCACCACAAGAAAGAGGAGGG - Intronic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1151039672 17:70844056-70844078 TATGACAATCAGAAAGTGGAAGG - Intergenic
1151309151 17:73282850-73282872 TGTCACCACCAGAAAGTGGCTGG - Intergenic
1156519513 18:37710134-37710156 TTTCAAACCCTGAGGGTGGATGG - Intergenic
1160149524 18:76388494-76388516 TTTCAGATCCACAAGGAGGAAGG + Intronic
1160920308 19:1516438-1516460 TTTCAGCACGTGAAGGTGGAGGG - Intergenic
1161637147 19:5396062-5396084 TGCCACAAACAGAAGGTGGGTGG + Intergenic
1162199085 19:9008361-9008383 TTTCTCAGCCACAGGGTGGAGGG + Intergenic
1164515185 19:28928258-28928280 ATTCTCATCCAGAAAGTGGAGGG + Intergenic
1165139215 19:33689013-33689035 TTTCACACCCAGGAGGCTGAGGG - Intronic
926958193 2:18325153-18325175 TTTCACATCCATCAGATGGACGG - Intronic
927966807 2:27275499-27275521 TTTCACACCCAAAAGGATGAAGG + Exonic
930141397 2:47954438-47954460 TTTCAGGTCCAGAAGGAGGAGGG - Intergenic
930579829 2:53196865-53196887 TTGCTCAACCATAAGGTAGAAGG - Intergenic
931541259 2:63331680-63331702 TTTCAAAGCCTGAAGGTGGGTGG - Intronic
931570634 2:63665681-63665703 TTTGACAACTAGGAGGTGGCTGG + Intronic
933060414 2:77729763-77729785 TATCACGACCAGAAGTTGAAGGG + Intergenic
935497875 2:103804058-103804080 TCTTCAAACCAGAAGGTGGATGG - Intergenic
936025360 2:109027528-109027550 TATCATAAACAGAGGGTGGATGG - Intergenic
936680036 2:114759612-114759634 CTTCACAACCAGAAGGTTGTGGG + Intronic
936688230 2:114853840-114853862 TTTCACAACCACATGGTCTAAGG - Intronic
938304833 2:130246062-130246084 TTCCTCAAGCAGATGGTGGAAGG + Intergenic
938449180 2:131401138-131401160 TTCCTCAAGCAGATGGTGGAAGG - Intergenic
938801898 2:134771377-134771399 ATTCACATCCAGTAGGGGGAGGG + Intergenic
938925070 2:136031699-136031721 AGTCACAACCAGAAGGTGTTTGG - Intergenic
938964704 2:136377949-136377971 TTTTAAAATCAGTAGGTGGAAGG + Intergenic
939385210 2:141487117-141487139 TTTCCCAGGCAAAAGGTGGAGGG - Intronic
940705813 2:157103735-157103757 TCTCACAACTAATAGGTGGAAGG + Intergenic
941237901 2:162997878-162997900 TTTCAAGACCACAAGGAGGATGG - Intergenic
941862929 2:170303387-170303409 TTTTACACCCATAAGATGGATGG - Intronic
945482626 2:210361086-210361108 TTTCACAGCTGGAAGGTGGGTGG - Intergenic
946919316 2:224561752-224561774 TTTCACAAACAGAAGATTCAAGG + Intronic
1169670476 20:8094667-8094689 TTTCACAATGAGAAAGTGAAGGG - Intergenic
1170552255 20:17488181-17488203 TTTCCCAACATGAAGGTGGAAGG + Intergenic
1171026073 20:21631556-21631578 TTTCAAAACAAAAATGTGGAAGG - Intergenic
1171503089 20:25609859-25609881 TTCCACATCAAGATGGTGGATGG + Intergenic
1178699092 21:34818468-34818490 ATTCAGAACCAGAAGGAGGGGGG - Intronic
1179225421 21:39448712-39448734 TGTCACAGCCAGAAGGATGAGGG + Intronic
1184190428 22:42891020-42891042 TTTCACAAGCAGATGATGGGCGG - Exonic
1184943450 22:47784749-47784771 TTTCCCAAGCAGATGGTGGAAGG + Intergenic
950492373 3:13313874-13313896 TTTCACCATCTGTAGGTGGATGG + Intergenic
951460864 3:22950238-22950260 TGCCACAACCAGAAGGGAGAGGG + Intergenic
952465151 3:33576503-33576525 ATTTACAACCACAAGGTAGAAGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954807878 3:53230816-53230838 TTTCACAGCCAGAAGGGGCCGGG - Intronic
955458550 3:59152737-59152759 TAACACAAACAGAAGGTGGGAGG - Intergenic
955807626 3:62753904-62753926 TTGCACAGCCAGGAGGTGGTGGG - Intronic
956566347 3:70642993-70643015 TGACACAGCCACAAGGTGGAGGG - Intergenic
957895776 3:86420001-86420023 TTTTAAATCCAGAAGATGGAGGG - Intergenic
959211120 3:103382234-103382256 TTTTATCCCCAGAAGGTGGATGG - Intergenic
961352656 3:126313916-126313938 TTACACAAACAGATGGTAGACGG - Intergenic
961483806 3:127202522-127202544 TTTCATAAACAGCAGGTCGATGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963105535 3:141644088-141644110 ATACACACCCAGAAGGTGAAGGG + Intergenic
963405307 3:144855751-144855773 TTTCACAATCAGAAATTGGAGGG - Intergenic
963785922 3:149534360-149534382 TCTCACAGCCAGCAGGTGAAAGG - Intronic
964801474 3:160564346-160564368 TACCACCACCAGCAGGTGGAGGG + Intronic
965540197 3:169864262-169864284 TGTAGCAACCAGAAGGTAGAGGG - Intronic
965964816 3:174474658-174474680 TTTAAACACAAGAAGGTGGAAGG - Intronic
967527911 3:190515030-190515052 TTTCACAACCAGAAGGTGGAGGG - Intronic
969460024 4:7324095-7324117 TCCCACAACCAGCAGGTGGCGGG + Intronic
971274095 4:25179009-25179031 TATCACAACAAGAAGGAGGCTGG + Intronic
971471292 4:27029598-27029620 TTTACCAACCTGGAGGTGGAAGG - Intergenic
972417474 4:38856083-38856105 TTTGTCAAACTGAAGGTGGAAGG + Intronic
972712287 4:41609436-41609458 TTCCACAACCAGAGGGTGGTGGG + Intronic
972762251 4:42118432-42118454 TTTCCCAACCAAAAGCGGGATGG + Intronic
973839414 4:54845559-54845581 TATGCCAACCAGAAGATGGATGG + Intergenic
977514445 4:98003232-98003254 TTTTACAGGCAGAAGCTGGAAGG + Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978329544 4:107597787-107597809 ATTCACAACCCTATGGTGGAAGG - Intronic
978412827 4:108443854-108443876 TTTTTCATCCAGAAGGTGGCGGG - Intergenic
982516354 4:156355247-156355269 TTTCAATACCAGAAGCTGAAGGG - Intergenic
985129750 4:186727172-186727194 ATTCACATCCAGAAGTTGGAGGG - Intergenic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
987448292 5:18049381-18049403 TTTCAAAACTAGAAGGGGAAAGG - Intergenic
989021026 5:37009066-37009088 TGTCACAACTGGAAGGAGGAAGG - Intronic
989256646 5:39373094-39373116 TCTCCCAACCAGAGGGTAGAAGG + Exonic
995787758 5:115848737-115848759 TTATACAACAAGAAGTTGGAAGG - Intronic
999139978 5:149354143-149354165 TTTAAAAACCAGAAAATGGAAGG - Exonic
1000967050 5:167670202-167670224 TTTCACATCAAAAAGATGGATGG + Intronic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1003513545 6:6801103-6801125 TTTCACAGCCAGCTGGTGGCAGG + Intergenic
1003631432 6:7791123-7791145 TTACCCCACCAGAGGGTGGAGGG + Intronic
1006622417 6:35375054-35375076 TTTCATAAACAGAATGTGGCTGG + Intronic
1006958929 6:37906454-37906476 TCACACAGCCAAAAGGTGGAAGG - Intronic
1008845913 6:55964015-55964037 CTTCAGAATCAGAAGGTGGCAGG - Intergenic
1012420681 6:99061591-99061613 TTTAAAAACCAGATGGAGGAAGG - Intergenic
1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG + Intergenic
1013714703 6:112944983-112945005 TGACACCACCAGAAGCTGGAAGG + Intergenic
1021592071 7:22274266-22274288 TTTCAGGTCCAGAAGGTAGATGG - Intronic
1021885609 7:25135305-25135327 TTTCTCAATCAGAAGGTTAAGGG + Exonic
1022009239 7:26294049-26294071 TTTCACAACCACTTGGTGAAAGG + Intronic
1023362769 7:39432751-39432773 TCTCAGAACCAGAGGGAGGATGG - Intronic
1024300715 7:47885529-47885551 TTGCACAACCAGCAAGTGGTGGG + Intronic
1028837954 7:95395947-95395969 TTTCCCAAGCAGAATGTTGAGGG + Intronic
1029877675 7:103771224-103771246 TTTTACAAGCAGAAGGTGATTGG - Intronic
1034383515 7:150719623-150719645 TTACACAACCAGCACGTGGTGGG + Intronic
1035646716 8:1228417-1228439 TTTCAAAATCAGAAGTTGGAGGG + Intergenic
1035776921 8:2195436-2195458 TTTCAGGACCAGAAAGTTGAAGG - Intergenic
1035961331 8:4141265-4141287 TTTCACTACCTGAAGGTCGCTGG - Intronic
1036013878 8:4758930-4758952 TTTCAGTAGCAGACGGTGGAGGG + Intronic
1036019800 8:4831851-4831873 TGCCACATCCAGAAGGTGCAAGG + Intronic
1036629954 8:10505019-10505041 TTTAAACACAAGAAGGTGGAAGG + Intergenic
1039848086 8:41340328-41340350 GTTCACATCCAGAAGCTGGAAGG - Intergenic
1041505034 8:58587257-58587279 TTTCTGATCCAGAAGCTGGAAGG - Intronic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1043890499 8:85647633-85647655 TTTCACCACCTCAGGGTGGAGGG - Intergenic
1044616586 8:94148611-94148633 TATCACAACCTTAAAGTGGAAGG - Intronic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1044922979 8:97185481-97185503 TTTAACAAACAGAAGTTGGCAGG - Intergenic
1045883657 8:107070325-107070347 TTTAAAAACCAGAAGATGGGAGG - Intergenic
1050282566 9:4066415-4066437 TTTCACAACCAGGAGGTGGCTGG - Intronic
1052525828 9:29618446-29618468 TTTCAAAATAAGAAGGTGGGTGG + Intergenic
1053472506 9:38356990-38357012 TTTCACCTCCAGTGGGTGGAGGG + Intergenic
1055611114 9:78025645-78025667 TTTCTCCCTCAGAAGGTGGAGGG - Intronic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1056268128 9:84920183-84920205 ATTCACATTCATAAGGTGGAGGG + Intronic
1056715962 9:89028313-89028335 TTTCAGAACAAGAGGCTGGATGG - Intronic
1057831404 9:98409841-98409863 TTTCAGGAACAGAAGCTGGAAGG - Intronic
1062197424 9:135281990-135282012 TTTCACAACCAGCACGTGTGTGG + Intergenic
1188405047 X:29797480-29797502 TTTAACAAACAGAAGGATGAGGG - Intronic
1190136708 X:47805180-47805202 CTTTAGAACCAGAAGGTGGCTGG - Intergenic
1190728689 X:53210067-53210089 TTTTACTAACAGAAGGTGAATGG + Intronic
1190914877 X:54803936-54803958 GTTCACAAGGAGAAGGTGGGAGG + Intergenic
1191051053 X:56193081-56193103 TTTGAGAACCAGAATGTGTAAGG + Intergenic
1192588821 X:72342579-72342601 TTTTAGAACTAGAAGCTGGAGGG + Intronic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1196164016 X:112518527-112518549 ACTTACAACCAGAAGGTGAAGGG + Intergenic
1196697609 X:118630235-118630257 TATCACAACTTGAAGGTGAATGG - Intronic
1197675216 X:129322604-129322626 CTTCACAGCCAGATGGTTGAGGG - Intergenic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1201374564 Y:13303306-13303328 TTCCACAATGAGTAGGTGGATGG + Intronic