ID: 967528590

View in Genome Browser
Species Human (GRCh38)
Location 3:190522737-190522759
Sequence CAGAATCTTTCATGTGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967528588_967528590 -10 Left 967528588 3:190522724-190522746 CCTTAAAATATCTCAGAATCTTT 0: 1
1: 0
2: 3
3: 60
4: 607
Right 967528590 3:190522737-190522759 CAGAATCTTTCATGTGTAGGAGG 0: 1
1: 0
2: 1
3: 15
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967528590 Original CRISPR CAGAATCTTTCATGTGTAGG AGG Intronic
901385228 1:8903864-8903886 CAGAATCTCACAGGTGCAGGTGG - Intergenic
902400037 1:16152597-16152619 CAGATTCCTTCCTGTGTAGCTGG - Intronic
902465056 1:16612289-16612311 CACAATTTTACATGTGCAGGTGG - Intronic
902498370 1:16890794-16890816 CAGAATCATTCCTGGGTCGGTGG + Intronic
904233418 1:29096656-29096678 CAGAATCTGTCCTGTGGAGGAGG + Intronic
909025780 1:70480350-70480372 CAGAAGTTTTCATGTTGAGGAGG - Intergenic
910526840 1:88188770-88188792 AATAATCTTTCAGGTTTAGGAGG + Intergenic
913591610 1:120334003-120334025 CATAATATTTTATGCGTAGGAGG - Intergenic
914411615 1:147434673-147434695 CAGAATCTTCAATGTGCAGATGG - Intergenic
914599199 1:149183947-149183969 CATAATATTTTATGCGTAGGAGG + Intergenic
914980015 1:152406340-152406362 TTGAATATTTCATGTGTAGACGG + Intergenic
918185226 1:182120975-182120997 CAGCAGCTTTCATGTGGTGGGGG + Intergenic
920642019 1:207761985-207762007 GAGAATGTTTCATGTGTACTTGG - Intronic
924184823 1:241476940-241476962 GAGGATCAGTCATGTGTAGGTGG - Intergenic
1063173056 10:3526804-3526826 CAGAATTTTTAATGTGTTGAAGG - Intergenic
1063956901 10:11275657-11275679 CAGAAGCTTTTATGTGAAAGTGG + Intronic
1067302822 10:45028353-45028375 CAAAATCTTTCAAGTGTACATGG - Intergenic
1067448326 10:46366666-46366688 CAGGATCCATCATGTTTAGGAGG + Intergenic
1067589051 10:47494100-47494122 CAGGATCCATCATGTTTAGGAGG - Intergenic
1067636176 10:48002191-48002213 CAGGATCCATCATGTTTAGGAGG - Intergenic
1069864522 10:71493379-71493401 CAGAATCTCTGTTGTGGAGGGGG - Intronic
1070132737 10:73666196-73666218 CAGGATCCATCATGTTTAGGAGG - Intergenic
1071210037 10:83330481-83330503 CAGAAACTTTGATATGGAGGTGG - Intergenic
1074717748 10:116235510-116235532 CAGAATCTTCCAGGGGTTGGGGG - Intronic
1077736605 11:4798336-4798358 CAAAATTTTTCATGTCAAGGTGG + Intronic
1079502310 11:21115284-21115306 CTTACTCTTTCCTGTGTAGGGGG - Intronic
1081388485 11:42501291-42501313 CAGCATTTTTCATGTTGAGGGGG - Intergenic
1085732413 11:79011033-79011055 TAGAATGTTTGATGTGTAGTAGG + Intronic
1089658147 11:119966868-119966890 CAGAATCTCTAATTTGTAGCAGG - Intergenic
1099169426 12:79345937-79345959 CAGATTCTTTGATGAGTAGATGG - Intronic
1099892809 12:88610395-88610417 CAGGGTCTTTCAGGTGTTGGGGG + Intergenic
1100429824 12:94521361-94521383 ATGAATCTTTCATATTTAGGTGG + Intergenic
1105026442 12:132852498-132852520 CAGGGTCTTTCCTGTGTGGGTGG - Intronic
1105906633 13:24817241-24817263 CAGGGCTTTTCATGTGTAGGAGG + Intronic
1107380789 13:39854865-39854887 CAGACTCTTTCCTGTGTTGCTGG - Intergenic
1107829196 13:44359434-44359456 CATTATCTTTCATATGTTGGAGG - Intergenic
1109121588 13:58464512-58464534 CAAAATATTTCATGTGAAGAAGG + Intergenic
1117924940 14:60768523-60768545 CAAAATCTTTCAAATGGAGGTGG + Intronic
1121025255 14:90610960-90610982 CAGCATCTTTCTTATGAAGGAGG + Intronic
1126218088 15:46180504-46180526 GAGAATGTTTCATGTGTACTTGG + Intergenic
1126874192 15:53021094-53021116 CAGAATCTTACATGTAAAGATGG + Intergenic
1128433843 15:67626128-67626150 AAGAATCTGTGATGTGGAGGGGG + Intronic
1129898993 15:79131019-79131041 CAGAAGCTGTCTTTTGTAGGGGG + Intergenic
1130573760 15:85072413-85072435 CAGAATCTCTGATGTGTAGCTGG + Intronic
1132139857 15:99383415-99383437 CAGAGTGTTTCAGGTGGAGGGGG + Intronic
1134292902 16:12917335-12917357 CAGAATATTCCGTGTGTAGGGGG + Intronic
1135432483 16:22397328-22397350 CAAAATCTTTCATCTGTAGAAGG + Intronic
1137354995 16:47753512-47753534 CTAAATCTTTCATCTGTATGGGG - Intergenic
1137373136 16:47927407-47927429 CAGAATTTTTCATCTGGTGGAGG - Intergenic
1140135331 16:72200544-72200566 CACCATCTTTCCTCTGTAGGAGG - Intergenic
1141238382 16:82241993-82242015 CATAATCCTTCATGCCTAGGGGG - Intergenic
1147233759 17:39040872-39040894 CAGATTCTTTCAAATGTAGAAGG + Intergenic
1148573596 17:48691079-48691101 CAGCATCTTGTTTGTGTAGGTGG + Intergenic
1156486309 18:37468095-37468117 CAGGATCGTTCATGTGGAAGAGG + Intronic
1158519226 18:58156834-58156856 CAGATTCTTTCATGGGAAGGAGG - Intronic
1160336289 18:78043114-78043136 CAGCATCTTTCTTCTGAAGGAGG + Intergenic
1165245973 19:34498514-34498536 CAGAACCTTCCATGAGGAGGTGG - Intronic
1166420147 19:42630366-42630388 CAGAAGCTTTCTCGTGAAGGAGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
927530565 2:23794678-23794700 CAGTATATTTCATGTGTATATGG - Intronic
930094412 2:47556091-47556113 CAGAAGCTTTCCTGTAAAGGAGG + Intronic
930137819 2:47920200-47920222 CAGAAGCTTTAATGTGATGGTGG - Intergenic
931198887 2:60077887-60077909 AACAGTCTTTCATGGGTAGGTGG - Intergenic
933267520 2:80198103-80198125 CAGATTTTTTCATGTGCATGAGG - Intronic
937015809 2:118604330-118604352 CAGAATCTTGCTTATGTAGTGGG - Intergenic
939585468 2:143999089-143999111 CAGAAACTTTTTTGTTTAGGGGG - Intronic
940815152 2:158289609-158289631 CAGGATCTTTTATATGTAGCTGG + Intronic
942353376 2:175078611-175078633 CAAAATCTTTCAAGTAAAGGTGG - Intronic
942413837 2:175737824-175737846 CTGAATGTTTCCTGTGTAGGTGG - Intergenic
945476047 2:210284318-210284340 GAAAAGCTTTCATCTGTAGGTGG + Intergenic
945579312 2:211572905-211572927 CAGTATCTTTCATGGGTAGGAGG - Intronic
947547616 2:231021800-231021822 CAGTATTTTTCAGGTGTTGGAGG - Intronic
948466548 2:238154677-238154699 CAGCATCTTTCCTGTGTACGTGG - Intergenic
1170857172 20:20068031-20068053 CTGAATCTTTAATGTCTATGTGG + Intronic
1173483707 20:43424211-43424233 CAGAATCTTTTGTGTCCAGGAGG + Intergenic
1173491004 20:43481506-43481528 CAGAAACTTTCCCGTGTAAGCGG - Intergenic
1176997221 21:15569744-15569766 CACATGCTTTCATGTGTAAGTGG + Intergenic
1180712648 22:17850012-17850034 AAGAATAGTTCATGTGTAGCAGG - Intronic
1183301752 22:37062228-37062250 CAGAATCTGGCCTCTGTAGGTGG + Intronic
949115189 3:312009-312031 AAGAATCTTACATGTATAGGTGG + Intronic
949201634 3:1387543-1387565 CAGAAACTCTTGTGTGTAGGGGG + Intronic
949409942 3:3752867-3752889 CACAATCTTCCATGAGTAGTCGG + Intronic
950111656 3:10422525-10422547 CAGTCTCTGTCATGTGGAGGGGG + Intronic
950434242 3:12968872-12968894 CTGAATCTTTCATTTGGAGGGGG + Intronic
951362337 3:21740056-21740078 CAGAAAGTTTCATGTGTACTGGG - Intronic
951963828 3:28359807-28359829 CATAATCTACAATGTGTAGGGGG - Intronic
959205877 3:103305735-103305757 CAAAATCTTTCAGGTGTATTTGG + Intergenic
961908278 3:130285579-130285601 TAGAATTCTCCATGTGTAGGTGG + Intergenic
962665862 3:137652989-137653011 TTGAATCTATCAGGTGTAGGTGG - Intergenic
963502709 3:146147959-146147981 CAGAATCTTTCTTGTTTTGGAGG - Intronic
963927851 3:150969976-150969998 CAGAATCTTACCAGTGTAAGAGG - Intronic
967437458 3:189465967-189465989 CAGTATCTTTCATCTGTCAGTGG + Intergenic
967528590 3:190522737-190522759 CAGAATCTTTCATGTGTAGGAGG + Intronic
968632023 4:1656714-1656736 CAGATTCTTTCATGAGTAGATGG - Intronic
969427905 4:7136645-7136667 TAGAATCTTACAGGTGGAGGCGG - Intergenic
969475515 4:7420518-7420540 CAGCTTCTTTCATGTGCAGCTGG + Intronic
970795378 4:19906107-19906129 CAGAATCTTTCAATTCTATGTGG + Intergenic
971892052 4:32537545-32537567 CAGAACCTTTCATTTGGAGGTGG - Intergenic
973874479 4:55203006-55203028 CAGAATCTTTCAGGTTTATCTGG - Intergenic
980743194 4:136978320-136978342 CAGCATTTTTCATCTGAAGGTGG + Intergenic
982185731 4:152796331-152796353 ATGAATCTTTCATATTTAGGTGG + Intronic
982185934 4:152798808-152798830 CAGAATTCTTCATATGTAGTTGG + Intronic
982986042 4:162207595-162207617 GAGAATGTTTCATGTGTATTGGG - Intergenic
982993215 4:162306013-162306035 AAAAGTCATTCATGTGTAGGTGG + Intergenic
983481077 4:168274753-168274775 CAGAATCTTTCTTATGATGGTGG - Intronic
984745902 4:183217220-183217242 CAGAATTTTTCATGTGTATTGGG + Intronic
985103899 4:186483546-186483568 GAGATTCTTTAATGTGTAGTTGG - Intronic
985301345 4:188493131-188493153 CAGAATCCTTCAGGCGTTGGAGG + Intergenic
985482616 5:125930-125952 CAGAATCTTTCAAGTCCAGAAGG - Intergenic
987084149 5:14453630-14453652 CAGAATGTTTGCTGTGTAGTGGG + Intronic
988260441 5:28880680-28880702 TAGAATTTATCATATGTAGGAGG - Intergenic
992241105 5:74770778-74770800 ATGAATCTTTCATATTTAGGTGG - Exonic
993100146 5:83528247-83528269 CAGAATATTTCATGAGAAAGAGG + Intronic
993450250 5:88064500-88064522 CAGAATGTTTCAAGTGTTGATGG - Intergenic
996905481 5:128595196-128595218 CAGAATCTGTCAGGTCTAAGAGG + Intronic
997152693 5:131515817-131515839 CAGAATCTAGAATGTGTAAGTGG + Intronic
1000319940 5:160126287-160126309 CTGAATGTATCATGTATAGGGGG + Intergenic
1000599975 5:163260882-163260904 CAGAATGTTGTATGAGTAGGAGG + Intergenic
1001884380 5:175275897-175275919 CAGAATTGTCCATGTGTAGTGGG + Intergenic
1007066773 6:38998219-38998241 CAGAATCTCTGAAGTGGAGGGGG + Intronic
1009217653 6:60943480-60943502 CAGATACTTTCATGTGGAGTAGG - Intergenic
1010252557 6:73723148-73723170 AATACTCTTACATGTGTAGGTGG - Intronic
1011948565 6:92936707-92936729 CAAAATCTTTCATGTCCTGGGGG - Intergenic
1014161410 6:118173292-118173314 CAGAAAATTTCATTTGTAGGAGG + Intronic
1014378856 6:120713857-120713879 CAGAATCTTCCATGGGCTGGTGG + Intergenic
1015481135 6:133711188-133711210 AAGAATCTTTTTTGTGTATGTGG + Intergenic
1017564519 6:155669537-155669559 CAGAATCTTTGATGGGTCTGGGG + Intergenic
1023765684 7:43508379-43508401 CTGAATCTTTCCTTTTTAGGTGG + Intronic
1027575685 7:79928185-79928207 CAGAATGGTTCATTTCTAGGTGG - Intergenic
1027683864 7:81256660-81256682 CAGGAACTTTCAGGTGAAGGGGG + Intergenic
1027914711 7:84301543-84301565 ATGAATCTTTAATGTGTATGTGG - Intronic
1028574289 7:92329528-92329550 CATAATCTTTATTGTTTAGGTGG - Intronic
1028820476 7:95205059-95205081 GAGAATCTTTCAAGTACAGGAGG - Intronic
1029214420 7:98936258-98936280 CAGAATCTTTCTTGAGTTAGAGG + Intronic
1033558987 7:142513189-142513211 CTGAATCTTTCATAGCTAGGAGG + Intergenic
1034388640 7:150764069-150764091 CAGATTCATTCATGTGTTGTGGG - Intergenic
1038712123 8:29957202-29957224 AAGAATCTTGGCTGTGTAGGAGG + Intergenic
1041856154 8:62457449-62457471 CAAATTCTTTCATCTGTTGGAGG + Intronic
1043649075 8:82565046-82565068 CAGAAACTGTCATTTCTAGGAGG - Intergenic
1043657491 8:82687891-82687913 GAGAATGTTCCATGTGTAGATGG - Intergenic
1043695036 8:83207396-83207418 CAGTAACTTTCATGTCTAGGAGG + Intergenic
1044393492 8:91681287-91681309 CAGATTATTTCATGTGGAGCTGG - Intergenic
1044593468 8:93936413-93936435 AAGAATCTTTCATGTGGCAGAGG + Intergenic
1046127641 8:109930006-109930028 CAGAATATTTCAAGAGTTGGTGG - Intergenic
1046269249 8:111871545-111871567 AAGAAGCTTTCATCTGTAAGAGG - Intergenic
1050387842 9:5110038-5110060 TTGAATCTCTCATGTGTTGGAGG - Intronic
1050644253 9:7702286-7702308 CAGAATCCTTCATGGGCTGGTGG - Intergenic
1052055592 9:23903383-23903405 TAGACTCTTACATGTGTAAGTGG - Intergenic
1055064927 9:72109277-72109299 CAGAATCTAGCAAGTGTAGATGG - Intergenic
1057280155 9:93703959-93703981 GAGAATGTTTCATGTGTACTTGG + Intergenic
1057594942 9:96407767-96407789 ATGAATCTTTCATATTTAGGTGG - Intronic
1060198150 9:121636419-121636441 CAGAAACTTTCAGGAGCAGGAGG + Intronic
1185478316 X:428249-428271 CGGAATCTTGCAAGTGTGGGAGG - Intergenic
1187109968 X:16287571-16287593 TAAAATGTTTCATGTGCAGGTGG + Intergenic
1189841372 X:45082113-45082135 AAGAAATTTTCATGTGTAAGAGG + Intronic
1190648369 X:52544223-52544245 CAGAATCTGTCCTCTGTTGGGGG - Intergenic
1194219581 X:91174998-91175020 CAGAATCCTTCCTGGATAGGTGG - Intergenic
1194973574 X:100370791-100370813 TATAATCTTTCATTTTTAGGAGG + Intronic
1195031446 X:100930829-100930851 CTGACTCTCTCATGTTTAGGGGG - Intergenic
1198081234 X:133241539-133241561 CAGAAAGTTTCATGGGAAGGTGG + Intergenic
1200556094 Y:4638762-4638784 CAGAATCCTTCCTGGATAGGTGG - Intergenic
1201583881 Y:15539180-15539202 CAGAATGTTTCCAGTGTAGCAGG + Intergenic