ID: 967529618

View in Genome Browser
Species Human (GRCh38)
Location 3:190533537-190533559
Sequence AAGGGGACTTAGGATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 348}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967529607_967529618 17 Left 967529607 3:190533497-190533519 CCCCTGTGCTTCCCCTGTCTGAA 0: 1
1: 0
2: 3
3: 23
4: 273
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348
967529610_967529618 6 Left 967529610 3:190533508-190533530 CCCCTGTCTGAACAACTACTCGA 0: 1
1: 0
2: 0
3: 6
4: 53
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348
967529612_967529618 4 Left 967529612 3:190533510-190533532 CCTGTCTGAACAACTACTCGATT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348
967529604_967529618 22 Left 967529604 3:190533492-190533514 CCTCCCCCCTGTGCTTCCCCTGT 0: 1
1: 0
2: 6
3: 64
4: 908
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348
967529601_967529618 29 Left 967529601 3:190533485-190533507 CCTCCTCCCTCCCCCCTGTGCTT 0: 1
1: 0
2: 12
3: 131
4: 1399
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348
967529605_967529618 19 Left 967529605 3:190533495-190533517 CCCCCCTGTGCTTCCCCTGTCTG 0: 1
1: 1
2: 0
3: 52
4: 440
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348
967529611_967529618 5 Left 967529611 3:190533509-190533531 CCCTGTCTGAACAACTACTCGAT 0: 1
1: 0
2: 0
3: 1
4: 45
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348
967529609_967529618 15 Left 967529609 3:190533499-190533521 CCTGTGCTTCCCCTGTCTGAACA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348
967529606_967529618 18 Left 967529606 3:190533496-190533518 CCCCCTGTGCTTCCCCTGTCTGA 0: 1
1: 0
2: 0
3: 36
4: 302
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348
967529608_967529618 16 Left 967529608 3:190533498-190533520 CCCTGTGCTTCCCCTGTCTGAAC 0: 1
1: 0
2: 0
3: 19
4: 234
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348
967529603_967529618 23 Left 967529603 3:190533491-190533513 CCCTCCCCCCTGTGCTTCCCCTG 0: 1
1: 0
2: 4
3: 74
4: 724
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348
967529602_967529618 26 Left 967529602 3:190533488-190533510 CCTCCCTCCCCCCTGTGCTTCCC 0: 1
1: 1
2: 10
3: 188
4: 2359
Right 967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967529618 Original CRISPR AAGGGGACTTAGGATGAGGA AGG Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
901161104 1:7177245-7177267 AAGGGGACTTAGTGTGTGGGAGG - Intronic
902006481 1:13236370-13236392 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902025534 1:13380755-13380777 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902318080 1:15638922-15638944 AAGGGGAGTTAGGAAGAAAAAGG - Intronic
903325563 1:22566877-22566899 ATGGGGACAGAGGAAGAGGAGGG + Intronic
903380830 1:22895954-22895976 GGGAGGACTTAGGAGGAGGAGGG + Intronic
903815155 1:26059504-26059526 AAGGGAGCTTCGGTTGAGGAGGG - Intronic
906086832 1:43143492-43143514 AAAGGGACTTATGATTTGGATGG + Intergenic
906523596 1:46481155-46481177 AAGGAGACTTACGGAGAGGAGGG + Intergenic
906591780 1:47031509-47031531 AAGGGGACTTTGAATGAGAGTGG - Intronic
907077712 1:51593454-51593476 GAGGGGAGTTAGGGTGAGGCTGG - Intronic
908261085 1:62339610-62339632 TAGGAGACATAGGATGAGGATGG + Intergenic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
909977712 1:82064713-82064735 AAGGGGTCACTGGATGAGGATGG - Intergenic
910119408 1:83768970-83768992 ACTTGGACTTAGGATGAAGATGG - Intergenic
912228967 1:107770061-107770083 AAGGGGACTGAGCATGAGGTGGG - Intronic
913181698 1:116328774-116328796 ATGGGGACAAAGGAAGAGGAAGG + Intergenic
913614035 1:120538423-120538445 CAGGGGACTTAGGAAGATGCAGG + Intergenic
914576233 1:148972470-148972492 CAGGGGACTTAGGAAGATGCAGG - Intronic
914708469 1:150191109-150191131 ACATGGACTTAGGGTGAGGAGGG - Intergenic
914805042 1:150985488-150985510 AAGGGGTGGTAAGATGAGGATGG - Intronic
915781398 1:158554662-158554684 AACGAGACTTGGGAAGAGGAAGG + Intergenic
916132507 1:161623725-161623747 AAGGGGACTGAGGATTGGGGTGG - Intronic
916457476 1:164985862-164985884 AAGGGTACTGAGGAACAGGAGGG + Intergenic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
918289092 1:183089053-183089075 AAGAGGAGTTAGGAAGAAGATGG - Intronic
918474198 1:184905587-184905609 CAGGGGACTTAGGGGGAGAAAGG - Intronic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920565623 1:206970446-206970468 AAGGGGACACAAGAGGAGGAAGG - Exonic
920972210 1:210752645-210752667 TAGGGAACAGAGGATGAGGAGGG + Intronic
921009653 1:211128541-211128563 TGAGGGACTTAGGATCAGGAAGG + Intronic
921345555 1:214180686-214180708 CAGGGGACTAAGGATAAGAATGG + Intergenic
921447889 1:215268124-215268146 ATGGGGAGTTAGAATAAGGATGG - Intergenic
922822395 1:228493451-228493473 AAGGGGTTTTAAGTTGAGGAGGG + Intronic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922994517 1:229945189-229945211 ATGGGGAATTGGGGTGAGGAGGG - Intergenic
924198823 1:241639669-241639691 GAGGGGACGGAGGAAGAGGAAGG + Intronic
924314386 1:242780796-242780818 TAGGGGACGTCGGATGAAGAAGG - Intergenic
924370690 1:243346970-243346992 AATAGGACTGAGGAAGAGGACGG - Intronic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1063891359 10:10632081-10632103 GAGGAGGCTTGGGATGAGGATGG - Intergenic
1063901505 10:10737619-10737641 AAGGGGATTCAGGCAGAGGATGG - Intergenic
1064156446 10:12906871-12906893 AAGAGGACCTAGGATGCTGAGGG - Intronic
1065319459 10:24495627-24495649 AAGAGGACTTAGGGGGAAGAAGG + Intronic
1066555257 10:36605476-36605498 ATGGTGACTCAGGATGAAGATGG + Intergenic
1067277168 10:44846089-44846111 AGGGGAACTTAGTTTGAGGAGGG - Intergenic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068564192 10:58553205-58553227 AAGGGGAATTAGGTTGCAGATGG + Intronic
1068892068 10:62158282-62158304 AAGAGCAGTTAGGAAGAGGAAGG + Intergenic
1069253736 10:66305493-66305515 AAGGGGATTTTGAATCAGGATGG - Intronic
1069980792 10:72251024-72251046 GAGGGGACTTAGGAGGGGGATGG + Intergenic
1070655795 10:78270209-78270231 AAGGGGACCAAGCATGGGGATGG + Intergenic
1070723609 10:78773301-78773323 AAGGGAGCTGAGGCTGAGGAAGG - Intergenic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1070937566 10:80313232-80313254 AACAGGACTGAGGATGATGATGG + Intergenic
1071257174 10:83881238-83881260 AAGGGGACTCACTATGAGAAAGG - Intergenic
1071411361 10:85400032-85400054 AAGTGGACTGAGGAAGGGGAAGG + Intergenic
1072576159 10:96702156-96702178 AAGGGGACTTGGGAAGATGCTGG + Intronic
1074208008 10:111301249-111301271 AAGGGGACATATGTTGGGGAAGG + Intergenic
1074313602 10:112343044-112343066 AAAGAGACATAGGAAGAGGAGGG - Intergenic
1074806859 10:117062562-117062584 AAGGTAACTGAGGCTGAGGAAGG - Intronic
1074824595 10:117205629-117205651 AAGGGGGCTTTGGCTGAGGTGGG - Intronic
1074950757 10:118332518-118332540 GAGGGGCATTAGGATGTGGAGGG - Intronic
1075214748 10:120522426-120522448 AAGGGCACTGAGGATCAGGCAGG + Intronic
1075341149 10:121647776-121647798 CAGAGGATTTAGGATGTGGAGGG + Intergenic
1076071168 10:127490970-127490992 AAGGGGACTGGGGAGGGGGAGGG - Intergenic
1076136849 10:128051140-128051162 AAGGGGAAATGGGATGAGAAGGG - Intronic
1076264456 10:129098896-129098918 AATGGGCCCTAGCATGAGGAGGG + Intergenic
1076442344 10:130488606-130488628 AAGGGGATTGAGGAAGAGGCAGG + Intergenic
1079360281 11:19765323-19765345 AAGAGGAGGAAGGATGAGGAAGG - Intronic
1080832294 11:35906835-35906857 GAGGGGACTTAGCATGAGAATGG - Intergenic
1084698758 11:70771972-70771994 AAGGTCTCTAAGGATGAGGACGG + Intronic
1086371060 11:86156354-86156376 TAGGGGAGTTAGGATAAGGCAGG - Intergenic
1086862740 11:91944208-91944230 AGAGGGAGTTAGGATGAGGGAGG - Intergenic
1086944321 11:92830120-92830142 AAGGGTATTTAGGATCAGAATGG + Intronic
1087105310 11:94401733-94401755 AGGGGCACTTGGGATGATGAGGG + Intergenic
1087305138 11:96480429-96480451 AAGGGGACTTAGATTCAGCAGGG + Intronic
1088194808 11:107262565-107262587 TAGGGGATTGAGGATGGGGAAGG + Intergenic
1089067923 11:115676067-115676089 GAGGGGGCTTGGGTTGAGGAAGG + Intergenic
1089269916 11:117295036-117295058 AAGGGGAATTAGCAGAAGGAGGG - Intronic
1089915532 11:122152098-122152120 AAGGGGGCTGAGGTGGAGGAAGG - Intergenic
1091576516 12:1741431-1741453 ATGGGGGCTTAGGAAGAGGGAGG + Intronic
1091694381 12:2618054-2618076 AAGGGGACTTTGGAGGCTGAGGG + Intronic
1091849115 12:3681011-3681033 AAGGGGGCTTAGGGAGAGCAGGG - Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092884266 12:12911812-12911834 AAGTGGTCCTAGGATGAGGTGGG + Intronic
1093517965 12:20013368-20013390 ATGGGGACTGAGGTTGAGGAGGG - Intergenic
1093670415 12:21867774-21867796 AAGGGGCCTGAAGAGGAGGATGG + Intronic
1094095600 12:26700721-26700743 AAGGGGACAGAGGATGAAAAAGG + Intronic
1094148464 12:27255822-27255844 ATGGGGTCTTAAGATCAGGACGG - Intronic
1094260362 12:28490156-28490178 AAGAGTAATTAGGATGAGAAAGG - Intronic
1096081693 12:48837579-48837601 AATGGAAATGAGGATGAGGAAGG - Exonic
1096537680 12:52286008-52286030 AAGGGGCCTCAGGAGCAGGAAGG - Exonic
1097993775 12:65865017-65865039 GAGGAGGCTGAGGATGAGGAGGG - Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1100365322 12:93915176-93915198 GAGAGGGCTCAGGATGAGGAAGG + Intergenic
1102204902 12:111083593-111083615 AAGAGGACTGAGGTTTAGGAGGG + Intronic
1102427869 12:112858574-112858596 CAGGGGACTTATGATGATTATGG + Intronic
1102579910 12:113879768-113879790 CAGGAGACTTAGGCTAAGGAGGG - Intronic
1103098325 12:118149998-118150020 AATGGGACTTAGGAAGGGGAAGG + Exonic
1104431991 12:128724036-128724058 AAGGTGACCTGGGATGAAGACGG + Intergenic
1106574155 13:30958601-30958623 AAAGGGATGTAGGATGAAGATGG - Intronic
1107120177 13:36787495-36787517 AGGGGGACTGAGGCTGGGGAGGG + Intergenic
1107369330 13:39726199-39726221 AAGAGGACTTAGGTTTAGGGTGG - Intronic
1108279364 13:48846021-48846043 AAGGAGATTTATGAAGAGGAAGG - Intergenic
1108499850 13:51060092-51060114 AAGGCGTCTTAGGAGGAGGAAGG - Intergenic
1110192911 13:72751937-72751959 AGGGGGACTGAGAATGATGAGGG + Intronic
1110400989 13:75091909-75091931 AAAGGGACTTTGAGTGAGGAGGG + Intergenic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1112158686 13:96846447-96846469 AAGAGGAGTTAGGGTGAGTAGGG - Intergenic
1113890713 13:113734331-113734353 AAGGGGTCACAGGATGAGGAGGG + Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114212510 14:20627086-20627108 AAGAGGATTTTGAATGAGGAGGG - Intergenic
1116529769 14:45955805-45955827 AAGTGGACTGAGGACGAGGATGG - Intergenic
1117968342 14:61228403-61228425 AAGGGAACTTGCTATGAGGAGGG - Intronic
1118798423 14:69166824-69166846 AAGGGAAGGTAGGATGAGGCTGG + Intergenic
1118838635 14:69494737-69494759 AAGGGGACTTTGGAATAGGGTGG + Intronic
1118981901 14:70723938-70723960 AAGATGACAGAGGATGAGGAGGG + Intronic
1120027785 14:79605398-79605420 AAGGAGTCTTAGGGTGTGGATGG + Intronic
1120503653 14:85327191-85327213 AAGGGGTTTTAGGATAAGGGTGG + Intergenic
1121316483 14:92964104-92964126 CGGGGGAATGAGGATGAGGAGGG - Intronic
1122284394 14:100642161-100642183 AAGGGGACTAGGGAGGAGGGAGG + Intergenic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122738012 14:103855017-103855039 ACGGGCCCTTAGGATGAGGAAGG + Intergenic
1122972435 14:105157903-105157925 ATGTGGCCTGAGGATGAGGAGGG - Intronic
1124395107 15:29294124-29294146 AAGGAGACTTAGGGTGGGTATGG + Intronic
1124812132 15:32951773-32951795 AAGGGGCCTTAGAAAGATGAAGG + Intronic
1129258141 15:74345922-74345944 AAGGGAACAAAGGATGTGGAAGG - Intronic
1132702585 16:1228451-1228473 AAGGGGGCTCAGGATGGGGAAGG + Exonic
1132705742 16:1242417-1242439 AAGGGGGCTCAGGATAGGGAAGG - Exonic
1133441816 16:5827706-5827728 AAGGGGACTTAGAATTAGGAAGG - Intergenic
1133909519 16:10052407-10052429 AAAAGGACTTAGGGTGAGCATGG - Intronic
1134031211 16:10993898-10993920 AAGGTGACCTGGGATGGGGAAGG + Intronic
1135357690 16:21783494-21783516 TTCAGGACTTAGGATGAGGAAGG + Intergenic
1135423827 16:22322590-22322612 CAGGGGTCTTAGGATGAGGCTGG + Intronic
1135456194 16:22599610-22599632 TTCAGGACTTAGGATGAGGAAGG + Intergenic
1135823649 16:25706737-25706759 AAGGGGAATTAGGTTGCAGATGG + Intronic
1136298091 16:29314931-29314953 AGGGTGACTTTGCATGAGGAAGG + Intergenic
1138339863 16:56281569-56281591 AAGGGGACTGAGAAGGAGGGAGG - Intronic
1138971467 16:62149382-62149404 AAAGGGACTTAGGAAGATAATGG + Intergenic
1139189951 16:64850862-64850884 AGGGGGAAATAGGAAGAGGATGG + Intergenic
1141980891 16:87549718-87549740 AAGGGGAGTGAGGAGCAGGAAGG - Intergenic
1142059737 16:88021436-88021458 AGGGTGACTTTGCATGAGGAAGG + Intronic
1142872400 17:2829321-2829343 GTGGTGACTTAGGATCAGGAAGG + Intronic
1143095266 17:4475476-4475498 GAGGGGAGTGAGGGTGAGGAAGG + Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143526827 17:7478006-7478028 GAGGGGATTTGGTATGAGGAAGG - Intronic
1143561802 17:7700908-7700930 CAGGGGTCTTTGGAGGAGGAAGG + Intronic
1143772641 17:9178457-9178479 GAGGAGAATTAGGAAGAGGAGGG - Intronic
1144468820 17:15518801-15518823 AAGGTGACTTGGCCTGAGGAAGG - Intronic
1144471977 17:15551881-15551903 AAGTGGACTTGGGATAAGCAGGG - Intronic
1144924502 17:18792828-18792850 AAGTGGACTTGGGATAAGCAGGG + Intronic
1146672506 17:34751308-34751330 AAGGAGACTTAGGCTCAGAATGG + Intergenic
1146805238 17:35859614-35859636 AAGGGAGCTGAGGGTGAGGAAGG - Intronic
1147485120 17:40805354-40805376 AAGGGTCCTTAGAAGGAGGAAGG + Intergenic
1150445747 17:65225896-65225918 AAGGGCACTTATGGTGAGGGAGG - Intronic
1150868099 17:68875866-68875888 TAGGGCAGGTAGGATGAGGAAGG + Intronic
1152222439 17:79075965-79075987 AAGGGGGCTTTGGAAAAGGAAGG + Intronic
1153110569 18:1581303-1581325 AAGGGGACTCAGCATCAGAAAGG - Intergenic
1155205861 18:23557316-23557338 AAGGGGACTTAGGGGAAAGAAGG - Intronic
1155229306 18:23757447-23757469 GAGGGGACTGGGGAGGAGGAGGG - Intronic
1156660276 18:39338246-39338268 AAGGGCACTTAGCAGGAGGTTGG - Intergenic
1157436232 18:47671802-47671824 GAGGGCACTCAGAATGAGGATGG + Intergenic
1157763392 18:50281192-50281214 GGGGGGATTTAGGCTGAGGACGG - Intronic
1157810989 18:50695687-50695709 AAGGCTGCATAGGATGAGGACGG + Intronic
1157886168 18:51369050-51369072 GAGGGGACAGAGGATGAGCAGGG - Intergenic
1159196192 18:65118911-65118933 ATGGAGATTTAGGATGTGGAGGG - Intergenic
1160385287 18:78493049-78493071 AGGGGGACTGTGGCTGAGGAGGG + Intergenic
1160972093 19:1774076-1774098 AAGAAGACTTTGGAGGAGGAGGG - Intronic
1161349641 19:3784753-3784775 AAGGGGTCTCAGGGTGTGGACGG + Intronic
1161373110 19:3924679-3924701 ATTGGGACTCAGGATGAGGCAGG - Exonic
1161821530 19:6533528-6533550 AAGGGGTCTTTGGAGGGGGAAGG - Intronic
1161821566 19:6533613-6533635 AAGGGGTCTTTGGAGGGGGAGGG - Intronic
1161918304 19:7247227-7247249 AAGTGGATTAAGGATGGGGAAGG - Intronic
1161998469 19:7729156-7729178 GAGTGGAGTTAGGATGAGGTCGG + Exonic
1162396904 19:10422606-10422628 AAAGAGACTTAGGAAGAGTAGGG - Intronic
1163438871 19:17311532-17311554 CAGGGGCCTCAGGGTGAGGAGGG - Intronic
1163606422 19:18278311-18278333 AAGGGAACTGAGGCTGAGGTGGG - Intergenic
1164017978 19:21269625-21269647 AAGGGGACTGAGGCTGAGATGGG + Intronic
1164456336 19:28410410-28410432 AAGGAAACTGAGGCTGAGGATGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1165792446 19:38500293-38500315 GAGAGGACTCAGGATGGGGATGG + Intronic
1166606108 19:44144168-44144190 ATGGGGATTTAGGATAAGAATGG - Intronic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1167644345 19:50697540-50697562 AAGGGAACTTGGGGTGAGGGGGG + Intronic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
925044903 2:765795-765817 AAGGAGACTGAGGCAGAGGAAGG + Intergenic
925405983 2:3605650-3605672 AAGCGGACCGCGGATGAGGAGGG - Intronic
925886184 2:8395239-8395261 AAGGGGAGTTGGAAAGAGGAGGG - Intergenic
926653782 2:15376056-15376078 TAGGGGAACTAGAATGAGGAGGG + Intronic
928127981 2:28629214-28629236 AAGGGCACCTGGGGTGAGGAGGG + Intronic
929034720 2:37679754-37679776 AGGAGGACTCAGGAAGAGGAAGG - Intronic
931431468 2:62212158-62212180 AAGGGGACCTTGTAGGAGGAAGG + Intronic
932275870 2:70451883-70451905 CAGTGGTCTTAGGAAGAGGATGG - Intronic
932404504 2:71504321-71504343 AAGGGGTCTTAGGCTGGGGATGG + Intronic
932741433 2:74293797-74293819 AAGGGGACTCATGATTAAGAAGG - Intronic
932824677 2:74928435-74928457 ATGGGCACTTAGGATGATCAGGG + Intergenic
933571789 2:84022429-84022451 CAAGAGACTGAGGATGAGGAGGG + Intergenic
933949486 2:87315760-87315782 AAGGGAACTGAGGATCAGGTTGG - Intergenic
935412964 2:102785227-102785249 AAGGGGACTGAGGAGGAGTGGGG - Intronic
936330707 2:111545837-111545859 AAGGGAACTGAGGATCAGGTTGG + Intergenic
937315586 2:120930239-120930261 AAGGTCAGTTATGATGAGGAAGG - Intronic
938161931 2:128993665-128993687 AAGGTGGATGAGGATGAGGAAGG + Intergenic
938751871 2:134339616-134339638 AAGGGGAGTTGGGATTAGCATGG + Intronic
939287209 2:140147545-140147567 AAGGGCACAAAAGATGAGGAGGG + Intergenic
939741570 2:145914663-145914685 AAAGGGACAAAGGATGAGAATGG + Intergenic
940674048 2:156706913-156706935 AAAGGGACTTAGGAGGTAGAGGG + Intergenic
942983158 2:182106441-182106463 AAGGGGAATTTGGTTGAGGGTGG + Intronic
943082691 2:183275585-183275607 AAGGGGACATATGCTGAAGAGGG + Intergenic
945230973 2:207589481-207589503 AAGGGGAATTAGGTTGCAGATGG - Intronic
947087864 2:226476013-226476035 AAGGGGCCTTGGGATTAGAAAGG - Intergenic
947224137 2:227823936-227823958 AAAGGGACAGAGGATGGGGATGG + Intergenic
947510998 2:230754348-230754370 AAGGGGACGGAAGAAGAGGAAGG - Intronic
1170235724 20:14102783-14102805 ATGGGGATATAGGATGGGGATGG + Intronic
1171796096 20:29567764-29567786 AAGGGGCCACAGGATGAGGTGGG - Intergenic
1172851718 20:37971156-37971178 AAGGGTAACTAGGATGTGGAAGG + Intergenic
1173153632 20:40588990-40589012 AAGGGGAATTAGGTTGCCGATGG - Intergenic
1173160639 20:40649660-40649682 AAGTGGACTGAGGATGATGATGG + Intergenic
1173607977 20:44345461-44345483 GAGGGCACTTAGAATGAAGAAGG - Intronic
1174028800 20:47603733-47603755 AAGAGGAGTTCGGCTGAGGACGG - Intronic
1174049170 20:47755750-47755772 AGGGGGCCTTAAGAAGAGGAAGG - Intronic
1174166093 20:48584539-48584561 AAGGGGACGTAGAAGAAGGAAGG - Intergenic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174523699 20:51154910-51154932 AAGTGGACTAAGAGTGAGGAAGG - Intergenic
1175125097 20:56745475-56745497 AAGGGGACTAAGGATTGGGCTGG - Intergenic
1175169727 20:57071752-57071774 AAGGGGGTTTATGATGAGAAAGG - Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175387056 20:58604206-58604228 GAGGGGGCTTTGGATGAGGTGGG + Intergenic
1177156949 21:17510380-17510402 AAAAGGATTTAGGAGGAGGAGGG - Intergenic
1179131187 21:38638803-38638825 AAGGGGATGTGGGAGGAGGAGGG - Intronic
1181636674 22:24177871-24177893 AAGGGGGCCTAGGATGGGGGTGG + Intronic
1183247073 22:36702277-36702299 AAGGGGACTTATTTGGAGGAGGG + Intronic
1183681004 22:39329171-39329193 AAGGGAACTGAGGCTGAGAAGGG - Intergenic
1184434100 22:44459570-44459592 AAGGATATTTAGGATGAAGATGG - Intergenic
1184541980 22:45132183-45132205 AGGGAGACTGAGGGTGAGGATGG - Intergenic
1184981269 22:48097389-48097411 AAGGGGCCTTAGGATGGAAATGG - Intergenic
1185052677 22:48562094-48562116 GAGGGGGCTTAGGATAAGGAGGG - Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949317050 3:2768602-2768624 AATGGCACTTAGGCTGAGGCAGG + Intronic
949628125 3:5891088-5891110 CAGAGGAATTAGGATGAAGATGG - Intergenic
951816005 3:26755655-26755677 TTGGGGAATTAGGATGAGGTGGG + Intergenic
952406828 3:33012685-33012707 AAGGGGACTTAGGCTTAGAAAGG - Intronic
953305102 3:41821707-41821729 AAGGGGCCAAGGGATGAGGAGGG - Intronic
954007777 3:47605904-47605926 AAGGTGACTCAGTATGATGAGGG + Intronic
954846487 3:53563180-53563202 AGGGGGACAGAGGATAAGGATGG - Intronic
956380871 3:68663303-68663325 GAGGGGACTTGGGAATAGGAGGG - Intergenic
956784570 3:72631754-72631776 AAGGGAAATTAAGATGAGGCAGG - Intergenic
958523989 3:95228591-95228613 AAGGTGACTAAGGATGACTAAGG - Intergenic
959142932 3:102507541-102507563 GAGGGGAGTTAGGAGAAGGAAGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
963868250 3:150385797-150385819 AAGGGGATTTGGGGTGAGGCAGG + Intergenic
964154238 3:153564992-153565014 AGGGGGACTTAAGTTGAGAAGGG + Intergenic
965405287 3:168260646-168260668 AAGGGGCCTGAGGCTCAGGAAGG + Intergenic
965556674 3:170025640-170025662 ATGAGAACTGAGGATGAGGAAGG + Intergenic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
967343644 3:188428361-188428383 TATGGGACTTAGGATGAAGATGG - Intronic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
968057813 3:195706016-195706038 AGGGGGAGATAAGATGAGGACGG - Intergenic
968744438 4:2352393-2352415 AAGGGGAGATAGGAGGAGGGAGG + Intronic
969143332 4:5099282-5099304 AAGGGGACTTAGGTTGCAGATGG - Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969651156 4:8469130-8469152 AAGAGGACAAAGGATGAAGAAGG - Intronic
971581891 4:28352106-28352128 ATGGGCACTAAGGATGAGGTTGG - Intergenic
972078528 4:35118026-35118048 AAAGGGATTTAGGAAGAGGATGG + Intergenic
972394679 4:38648856-38648878 AAAGGTAGTTAGGATGAGGCAGG + Intergenic
973738705 4:53898839-53898861 AAGTAGACATAGTATGAGGAGGG + Intronic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974430056 4:61784907-61784929 AAGGGTACTGAGGCTGAGAAAGG - Intronic
974500192 4:62689475-62689497 AATAGTATTTAGGATGAGGATGG - Intergenic
977254676 4:94727580-94727602 AAGGGGAGTTTGGCTGGGGACGG + Intergenic
978584289 4:110261081-110261103 AATGAGACGTGGGATGAGGAAGG + Intergenic
978982840 4:114970750-114970772 AAAGGGACTTGGGATTAGGATGG + Intronic
982874120 4:160624211-160624233 AAAGGGACTTAGATTTAGGAAGG - Intergenic
983237208 4:165193094-165193116 AAGGGGACTTCGCAAGAGCATGG - Intronic
983477927 4:168238480-168238502 AAGGGGAGAAAGGAAGAGGAAGG + Intronic
984613409 4:181867370-181867392 ATGGAGACTGAGGATGAGTATGG - Intergenic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
985168478 4:187123229-187123251 AAGTAGACTGAGGAGGAGGAAGG - Intergenic
986968869 5:13308324-13308346 AAGGGAACTGAGGGTGAGGCAGG - Intergenic
987241330 5:16003279-16003301 ACGGGGGCTCAGAATGAGGAAGG - Intergenic
988839179 5:35066562-35066584 AAGGGGAAATAAGAAGAGGAAGG - Intronic
990263159 5:54047023-54047045 ACTGGGACTTTGGATCAGGAGGG + Intronic
991606782 5:68410369-68410391 AAAGGGGGTTAGAATGAGGATGG - Intergenic
992762036 5:79959053-79959075 AAGGGAACTGAGGAAGCGGATGG - Intergenic
995026783 5:107432874-107432896 GAGTAGACTGAGGATGAGGAGGG - Intronic
995847494 5:116509735-116509757 AAGGGGACCCAGGCTGAGGTGGG + Intronic
999884434 5:155905414-155905436 AAGGAGGCTTAGAAAGAGGATGG + Intronic
1000188676 5:158886719-158886741 AAGGAGACTTAGGCTGGGCATGG + Intronic
1000371660 5:160542360-160542382 AAGGGGATTAAGGAAGAGAAAGG - Intergenic
1000987153 5:167873698-167873720 AAGGAGACCTGGGATGAGGGAGG + Intronic
1002107678 5:176888206-176888228 AAGGGCACTTAGGCAGAGGGAGG - Intronic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1004014552 6:11720161-11720183 AAGGGGGCTCAGGCTGTGGAAGG + Intronic
1004167579 6:13270453-13270475 TAGGTGACTTAGGATGGGGCTGG - Intronic
1005512264 6:26521676-26521698 ACGGGGAGTAAGGATGAGGTGGG - Intergenic
1005802428 6:29440623-29440645 AAAGGGGCAGAGGATGAGGAGGG - Exonic
1010649973 6:78442560-78442582 AGTGGGATTTAGGATGAGGTGGG - Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1015286412 6:131490628-131490650 TAGGGGACTCAGGATGGGGCTGG + Intergenic
1016914867 6:149235461-149235483 AAGAGGAACTAGGATCAGGAGGG + Intronic
1017034203 6:150252355-150252377 AAGAGGACTCTGGATAAGGAGGG - Intergenic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1019021979 6:168927078-168927100 AAGGCGACATAGCATTAGGAAGG + Intergenic
1020787116 7:12587348-12587370 GTGGGGAGTGAGGATGAGGATGG + Intronic
1021623516 7:22570769-22570791 AAGGGGAATTGGGAGAAGGATGG + Intronic
1021781367 7:24109866-24109888 AAGTGGCCTTAGGACCAGGATGG + Intergenic
1023396867 7:39759562-39759584 AAGGGGACTAGGGATGGGGTAGG - Intergenic
1024675606 7:51635638-51635660 AAGGGGATTTAACAAGAGGAGGG - Intergenic
1024902502 7:54336469-54336491 AAGGGTATTTAGGATGAGACTGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026968645 7:74454904-74454926 CAGGGTACTTAGGATGGGGCGGG - Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027333433 7:77122953-77122975 AAGGTCACTTAGGGTCAGGACGG - Intronic
1029782362 7:102748361-102748383 AAGGTCACTTAGGGTCAGGACGG + Intergenic
1030960387 7:115913090-115913112 AATGGGAATAAGGGTGAGGATGG - Intergenic
1032577733 7:133073294-133073316 AAGGGCACATAGAATGAGAAGGG - Intronic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033839704 7:145359475-145359497 AAGGGGATTGTGGATGATGAGGG + Intergenic
1033928141 7:146489258-146489280 AAGGAGACTGAGGATCATGAAGG - Intronic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034440299 7:151082691-151082713 GAGGGGACGGAGGCTGAGGACGG - Intronic
1034700153 7:153088485-153088507 TAGGGGGCTTAGGCTGAGCAGGG + Intergenic
1035060539 7:156066256-156066278 ACGTGGAATGAGGATGAGGATGG - Intergenic
1035239565 7:157520926-157520948 AAGGAGACTGGGGAGGAGGAGGG + Intergenic
1035416888 7:158696726-158696748 GTGTGGACTTAGGAGGAGGAGGG - Intronic
1035575688 8:703267-703289 GTGGGGCCTTAGGAGGAGGATGG - Intronic
1036188651 8:6648924-6648946 CAGGTGACTAAGGATGACGAAGG + Intergenic
1038240728 8:25806036-25806058 AAAATGACATAGGATGAGGATGG + Intergenic
1038404051 8:27308888-27308910 AAGGGTAGTTAGAATGAGGAGGG - Intronic
1038417948 8:27411276-27411298 AAGAGGATTCAGGCTGAGGAAGG + Intronic
1038451644 8:27643217-27643239 AAGGGGATTTAGGATAAAGCAGG + Intronic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1039567784 8:38563854-38563876 AAGGGGAATGGGGAGGAGGAGGG - Intergenic
1041433838 8:57816666-57816688 AAGGAGACTTAGGTTTAAGATGG + Intergenic
1042672073 8:71275325-71275347 TACGGGACTTAGGAGGAAGAAGG + Intronic
1046032325 8:108797879-108797901 AGAGGGACTTTGGAGGAGGAGGG + Intergenic
1047186915 8:122641968-122641990 ACTGGGACTTGGGGTGAGGAAGG - Intergenic
1047201766 8:122773190-122773212 AAGGGGTATAAGGATGTGGATGG + Intergenic
1047380377 8:124356488-124356510 AAGGAAACTTTGGATGTGGAAGG - Intronic
1047725429 8:127679950-127679972 AAGAGGACTCAGGGTGGGGAAGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048222538 8:132555129-132555151 AAGGAAACTGAGGAAGAGGAAGG - Intergenic
1048293755 8:133199471-133199493 AAGAGGACTTAGAAAGAGGTTGG + Intronic
1050268195 9:3913555-3913577 AAGGGGACTCCAGATGAGGGAGG - Intronic
1050349958 9:4731850-4731872 AAGTAGACTGAGGAGGAGGAGGG - Intronic
1053160882 9:35812666-35812688 AAGGGCGCTTAGGAGGAGGGTGG - Intergenic
1054155218 9:61635096-61635118 AAGGGGCCACAGGATGAGGTGGG - Intergenic
1054919636 9:70528994-70529016 AAAAGTTCTTAGGATGAGGATGG + Intergenic
1055121374 9:72664614-72664636 AAGAGGAGTTTGGATGGGGATGG + Intronic
1056081902 9:83103742-83103764 CAGGGGTCTAAGGAAGAGGATGG - Intergenic
1056318971 9:85418843-85418865 AAGGGAACTGAGGCTCAGGAAGG + Intergenic
1057073575 9:92121605-92121627 GAGGGGAGTTGGGATGAGGAAGG - Intergenic
1057318245 9:93986441-93986463 CAGGGGACTCAGGATGATTAAGG - Intergenic
1057499109 9:95582679-95582701 ATGGGGAATTAGGATGATGGTGG + Intergenic
1058951793 9:109910809-109910831 AGAGGGACTGAGGCTGAGGAGGG + Intronic
1059241575 9:112810706-112810728 GAGGGCACTTAGGTTGTGGAAGG + Intronic
1059681358 9:116589819-116589841 AGGGGGACTTATCATGAGGGAGG - Intronic
1060234438 9:121852603-121852625 AAGGTGACTGAGGATGAGGAAGG + Intronic
1060395100 9:123310757-123310779 CAGGGGACTGAGGCTGAGGCAGG - Intergenic
1060894829 9:127210935-127210957 AGGGGCACTCAGGAAGAGGAGGG + Intronic
1062194306 9:135264422-135264444 AAGGAGACTCAGGATTAGGAGGG + Intergenic
1186849892 X:13569824-13569846 AGGGGGGCTCAGGAGGAGGAAGG + Exonic
1189910826 X:45809331-45809353 AGGGGGCCTTTGGATGAGGAGGG - Intergenic
1192318183 X:70067668-70067690 AAGGGGACATAGGCTAAGCAAGG + Intergenic
1192452170 X:71251433-71251455 AAGGAGAGTTAGGAGGAGGGAGG - Intronic
1195210535 X:102650063-102650085 AAGGGTACTTTAGATGTGGAAGG - Intergenic
1196188013 X:112764912-112764934 AAGGTGCCTGAGGATGAGAAGGG + Intergenic
1196733967 X:118968581-118968603 AGGGGAACTGAGGATGAGGTAGG + Intergenic
1196861552 X:120033583-120033605 AAGAGGAGTTAGGCTGGGGACGG + Intergenic
1197380141 X:125729025-125729047 AAGGGGTATTATGATGAGAAAGG - Intergenic
1198662191 X:138981765-138981787 AAGGGGACTGAGTATGAGAAGGG - Intronic
1199323362 X:146467820-146467842 AAGGGGACTAATGAAGAGGGAGG + Intergenic
1199814285 X:151384156-151384178 AAGGGGACTTAGAGTGATGGGGG - Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1201695339 Y:16818278-16818300 ATGGGGACTTAGAAGGCGGATGG + Intergenic