ID: 967536024

View in Genome Browser
Species Human (GRCh38)
Location 3:190604407-190604429
Sequence TGTTAAGGTAGCCTGATTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967536018_967536024 14 Left 967536018 3:190604370-190604392 CCCACTCTCCTCAATGACACTGG 0: 1
1: 0
2: 0
3: 14
4: 191
Right 967536024 3:190604407-190604429 TGTTAAGGTAGCCTGATTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 85
967536021_967536024 6 Left 967536021 3:190604378-190604400 CCTCAATGACACTGGCAACTATA 0: 1
1: 0
2: 0
3: 5
4: 102
Right 967536024 3:190604407-190604429 TGTTAAGGTAGCCTGATTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 85
967536017_967536024 18 Left 967536017 3:190604366-190604388 CCGGCCCACTCTCCTCAATGACA 0: 1
1: 0
2: 2
3: 19
4: 241
Right 967536024 3:190604407-190604429 TGTTAAGGTAGCCTGATTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 85
967536020_967536024 13 Left 967536020 3:190604371-190604393 CCACTCTCCTCAATGACACTGGC 0: 1
1: 0
2: 1
3: 22
4: 218
Right 967536024 3:190604407-190604429 TGTTAAGGTAGCCTGATTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967536024 Original CRISPR TGTTAAGGTAGCCTGATTCT TGG Exonic
904195143 1:28779978-28780000 TGTGAAGATCGCCTGAGTCTGGG - Intergenic
911436413 1:97864899-97864921 TGTTTTTGAAGCCTGATTCTAGG + Intronic
915832649 1:159145632-159145654 TGTTAAGATAGATTGGTTCTGGG - Intronic
916547069 1:165815932-165815954 TGCTAAGGCAGCCTCATTCCCGG + Intronic
917253908 1:173093887-173093909 TGTTAAAGTAAGCTGATTCAGGG + Intergenic
917273475 1:173304515-173304537 TGTTAAGGCAAAATGATTCTGGG + Intergenic
919021585 1:192112741-192112763 TTTTAAGTAAGCCTCATTCTTGG - Intergenic
920619375 1:207529028-207529050 TCCTATGGTAGCATGATTCTAGG + Intronic
920621157 1:207547583-207547605 TCCTATGGTAGCATGATTCTAGG + Intronic
921943909 1:220873178-220873200 TGTCAAGGATGCCTGCTTCTGGG + Intergenic
1065048628 10:21767232-21767254 TGTAAAGGTATCATGGTTCTTGG - Intronic
1067519371 10:46984785-46984807 TGTTGAAGTTGTCTGATTCTGGG + Intronic
1067642876 10:48067054-48067076 TGTTGAAGTTGTCTGATTCTGGG - Intergenic
1070387485 10:75939085-75939107 TGTTAAGCTGGCATGATTTTGGG - Intronic
1071687003 10:87769252-87769274 TGAAAAGGTAGACTGCTTCTGGG - Intronic
1080090854 11:28347285-28347307 TAGTAGGGCAGCCTGATTCTTGG + Intergenic
1081663503 11:44902948-44902970 TGTGAAGGAAGCCTGGTGCTGGG - Intronic
1085726547 11:78960015-78960037 TTCTAAGGTACCCTGATTTTAGG - Intronic
1093744425 12:22723338-22723360 TGTTAGAGTAGCCTGATTTATGG + Intergenic
1101151267 12:101884730-101884752 TTTTAAAGTGGCTTGATTCTAGG - Intronic
1104485960 12:129151351-129151373 TGTTGGGGTTGCCTTATTCTGGG + Intronic
1106647516 13:31652597-31652619 TGTAAAGCTAGAGTGATTCTGGG - Intergenic
1117160745 14:52986983-52987005 TGTGAAGGAAGCCTGATGCTGGG - Intergenic
1130857966 15:87858062-87858084 TGCAAAGGTAGCCACATTCTGGG + Intergenic
1132422847 15:101688809-101688831 AGTTAAAGTAGCTTGCTTCTGGG - Intronic
1134070667 16:11257589-11257611 TGCTAAGCTGGGCTGATTCTGGG - Intronic
1137066889 16:35856041-35856063 TGTTAAGTTTGCCTTCTTCTGGG - Intergenic
1140267230 16:73431165-73431187 TGCTAAGGTAGTCTGTTTCTAGG + Intergenic
1152233891 17:79128530-79128552 TGTAGAGGTGGCCTGTTTCTGGG - Intronic
1153007571 18:511899-511921 TCTTAATGGAGCCTTATTCTTGG - Intergenic
1153198255 18:2624364-2624386 TGTGAAGATAGCTTGATACTGGG + Intergenic
1157165637 18:45356091-45356113 TGATAAGGTAGTCTGAAACTTGG - Intronic
1164425884 19:28141600-28141622 AGTGCAGGTAGCCTGAGTCTTGG - Intergenic
1167823902 19:51954127-51954149 TGTAAAGGTGGCATGAGTCTTGG - Intergenic
928372516 2:30751082-30751104 TGGTAAGGCAGCCTGCTTCAGGG - Exonic
931182233 2:59914667-59914689 TGTGGATGTAGGCTGATTCTTGG + Intergenic
934180423 2:89613930-89613952 TGTTAAGTTAGCCTACTTTTTGG - Intergenic
939582111 2:143962580-143962602 TGTCAAGGTATCCAGAGTCTGGG + Intronic
940210404 2:151250825-151250847 TGTAAAGCTAGCCTCATTCATGG + Exonic
940712947 2:157184291-157184313 CTTTAAAGTAGCATGATTCTTGG - Intergenic
943562920 2:189484424-189484446 TCTAAAGGTAGACTGATTCAGGG + Intergenic
944691878 2:202165892-202165914 TATCATGGTAGCCTGATCCTGGG + Intronic
946479159 2:220037305-220037327 TTTTAATTTAGCCTTATTCTTGG - Intergenic
948635939 2:239337639-239337661 TGTTAATTTATCCTCATTCTTGG - Intronic
1170094314 20:12629261-12629283 TGTAATGGGAGCCTGATCCTTGG - Intergenic
1170259375 20:14386712-14386734 TGTTCAGGAAGCATGATGCTGGG - Intronic
1170779333 20:19410170-19410192 TGATAAAGTCTCCTGATTCTTGG - Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1172123608 20:32612543-32612565 TGTTAAGGCAGCCTGAGGCGGGG - Intergenic
1172727793 20:37059832-37059854 TTTTAAGGAAGCATGATTCCTGG - Intronic
1174538883 20:51274054-51274076 TTTTAAGGCTGCCTGAGTCTTGG + Intergenic
1177510323 21:22078704-22078726 TGTTAAGGTAACCGGTTCCTTGG + Intergenic
1179945522 21:44671385-44671407 TGTCCAGGCAGGCTGATTCTTGG - Intronic
1181389183 22:22567239-22567261 TGGTAGGGTAGCCTGAGTCGTGG + Intergenic
1184440892 22:44514043-44514065 TGATAAGGTTTCCTGATTTTAGG + Intergenic
950950535 3:16993542-16993564 TGGTATGGCAGCCTGACTCTTGG + Intronic
951535266 3:23734833-23734855 TGTTAAGGTAGTAAGATTGTAGG - Intergenic
951713910 3:25618040-25618062 TGTGAACATAGGCTGATTCTGGG + Intronic
952153565 3:30619222-30619244 TGTTACGGTAGCATAATTCAAGG - Intronic
953457555 3:43054974-43054996 TGCCAAGGTAGCCTGCTCCTCGG - Intronic
955771984 3:62394496-62394518 TGTTAAGAGAGCCTGCTTCGTGG - Intergenic
956718568 3:72099093-72099115 TGTGAGGGCAGCCTGTTTCTTGG - Intergenic
961454998 3:127019643-127019665 TGATCAGATAGCCTGATCCTCGG + Intronic
962739495 3:138352670-138352692 CGTCAAGGTAGCCTGATGCGAGG - Intronic
967536024 3:190604407-190604429 TGTTAAGGTAGCCTGATTCTTGG + Exonic
977719428 4:100222945-100222967 GGTTCAGGGAGGCTGATTCTTGG + Intergenic
983589954 4:169397688-169397710 TATTAACCTAGCCTGATTCTTGG + Intronic
987843972 5:23257837-23257859 TGTTATGGTAGACTGCTGCTGGG - Intergenic
990066250 5:51718436-51718458 TGTTAATGTTTACTGATTCTTGG + Intergenic
992880537 5:81105121-81105143 TCTTAAGATACCCTGATTGTGGG + Intronic
998468327 5:142363659-142363681 TGTTCAGGTTGCTTGATCCTAGG + Intergenic
1009502837 6:64438077-64438099 TGTTAAGGTAGAATGATGTTGGG + Intronic
1015863952 6:137709015-137709037 TATTAATGTAGCTTGATGCTTGG - Intergenic
1035194039 7:157200187-157200209 GCTTAAGGTTTCCTGATTCTAGG + Intronic
1037538077 8:19845919-19845941 TGTTATGATAGTTTGATTCTGGG + Intronic
1038619473 8:29126556-29126578 GTTTAGCGTAGCCTGATTCTTGG - Intronic
1039307258 8:36276173-36276195 GGTGAAGGTTGCTTGATTCTGGG - Intergenic
1048057754 8:130884744-130884766 TGTTAGGGCAGCCAGAGTCTAGG + Exonic
1049128785 8:140817495-140817517 TGTTCAGGGAACATGATTCTAGG - Intronic
1050510648 9:6391225-6391247 TGTTGAGGTAGGTTCATTCTAGG - Intergenic
1051192856 9:14533580-14533602 GCTTAAGGTAGCCTGACTCTGGG + Intergenic
1051518902 9:17961868-17961890 TGAAAAGGAACCCTGATTCTTGG - Intergenic
1052641801 9:31177787-31177809 TATTAAGGTAGATTTATTCTGGG + Intergenic
1055618383 9:78096941-78096963 TGGTAAAGTAGAATGATTCTTGG - Intergenic
1055662691 9:78520597-78520619 GGTTCAGGTAGGCTGATTCTTGG - Intergenic
1055743040 9:79411012-79411034 GGTTAATGTAGCCTGAATCTGGG - Intergenic
1190781404 X:53599682-53599704 TATTAAGCTATCTTGATTCTCGG - Intronic
1190983917 X:55483761-55483783 TGCTATGATAACCTGATTCTGGG - Intergenic
1191684929 X:63879762-63879784 TGTCCAGGCAGGCTGATTCTTGG - Intergenic
1192584368 X:72307727-72307749 TCTTAAAGTCGCCAGATTCTGGG + Intergenic
1195211413 X:102654684-102654706 TGTTAAGACACCCTGGTTCTGGG + Exonic
1196998812 X:121415689-121415711 TGTTCAGGTGGGCTGATTCTTGG + Intergenic
1198129730 X:133681709-133681731 TGTTAGGGAAGCCTCTTTCTTGG - Intronic