ID: 967538057

View in Genome Browser
Species Human (GRCh38)
Location 3:190630258-190630280
Sequence GAGCAGCACTTCTGACAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967538057 Original CRISPR GAGCAGCACTTCTGACAAGA AGG (reversed) Intronic
900208589 1:1442047-1442069 GGGCAGCACTTCTCAGACGAGGG - Exonic
904471036 1:30736350-30736372 GAGCATCACTGCTGACAACTGGG - Intronic
905205451 1:36340584-36340606 GAACAGCATTTCTGGCAAGACGG + Exonic
905992314 1:42348908-42348930 GAGCTGCACTTCAGAGAGGAGGG + Intergenic
907087249 1:51686900-51686922 AAGCAGGACTTCTGCAAAGAAGG - Intronic
911483765 1:98479066-98479088 AAGCAGGACTTCTGAAAGGAAGG + Intergenic
912704484 1:111901865-111901887 GAGCATCAGCTCTGACCAGAGGG + Intronic
914986097 1:152458426-152458448 GAGCAGCACTTGGCACAAGGTGG + Intergenic
919016659 1:192047026-192047048 GAGCAGCCACTCTGACAACAAGG - Intergenic
919326435 1:196113029-196113051 AAGCAAAACTTCTGAGAAGAAGG + Intergenic
919826669 1:201507837-201507859 AAGCAGCAGTTCTGAAAAGTGGG + Intronic
921267792 1:213439566-213439588 GAGCAGCACCTGTGAAAGGAAGG + Intergenic
923008679 1:230071527-230071549 GACCTGCCCTTCTAACAAGAGGG - Intronic
923783361 1:237044505-237044527 GAGCAGCACCTTTGATAAGTGGG + Intronic
923986390 1:239387039-239387061 CAGCAGCGCTTCTGGGAAGACGG + Intronic
1064700107 10:18009672-18009694 GGGCGACACTTCTCACAAGAGGG - Intronic
1065698395 10:28401453-28401475 GCACAGCATTTCTGACAGGAGGG + Intergenic
1070097574 10:73352709-73352731 AAGCAGAACTTTTGAGAAGATGG - Intronic
1070154488 10:73825070-73825092 GAGCAGCACTTCTGCCATGCGGG + Intronic
1070597368 10:77841913-77841935 GAGCAGCACATCTGAGAAGAAGG - Exonic
1071223635 10:83499501-83499523 GAGCTGCACTTCTGGCAACATGG + Intergenic
1076439844 10:130473753-130473775 GGGAAGCACTCATGACAAGAGGG - Intergenic
1076679417 10:132163949-132163971 GAGAAGCCCTGCTGACTAGATGG + Intronic
1076893714 10:133298328-133298350 GACCTGCACTCCTGAGAAGAGGG - Intronic
1077133709 11:987999-988021 GTCCAGCCCTTCTGACAATAGGG - Intronic
1086082121 11:82914805-82914827 GAGAAGCACTTCTGACATGATGG - Exonic
1092393295 12:8100934-8100956 GAGCTGCTCTTCAGACAATATGG + Intergenic
1092490685 12:8942184-8942206 GAGCAACACTGTTGACCAGATGG - Intronic
1095509731 12:42937410-42937432 AAGCTGAACTTCTGACAAGTAGG - Intergenic
1102003682 12:109574821-109574843 CAGTAGGACTTCTGACAACATGG - Exonic
1105733635 13:23245564-23245586 GAGCAGCTCCTGTGACAAGAGGG + Intronic
1105770797 13:23610230-23610252 GAGCAGCTCTTCAGACCACAGGG - Intronic
1105916943 13:24925699-24925721 GAGCAGACCTTCTGAAAAGTCGG + Intergenic
1106845482 13:33733853-33733875 GAGCTGCACTTCTTAGCAGATGG + Intergenic
1107710708 13:43147685-43147707 GAGCATCACTTGAGACCAGAAGG + Intergenic
1109936692 13:69295349-69295371 AAGCAGCACTTTTTACAAGTTGG - Intergenic
1110737410 13:78953397-78953419 GAGCAGAACTTCTGACTATAGGG + Intergenic
1112140191 13:96632836-96632858 AAACAGTACCTCTGACAAGATGG + Intronic
1112197441 13:97239801-97239823 GTACAGCACGTCTGACAAAATGG + Intronic
1112741027 13:102472649-102472671 GAGCAGCACTCCTTCCAAGTTGG - Intergenic
1113168790 13:107474051-107474073 GAGCAACACTTGAGAGAAGAAGG - Intronic
1113202867 13:107886557-107886579 GATTAGGATTTCTGACAAGATGG + Intergenic
1113340946 13:109425339-109425361 GAGCTGTAATTCTGTCAAGAAGG + Intergenic
1113751496 13:112779597-112779619 GAGAAGCACTTCTGACATCTAGG + Intronic
1115677156 14:35689863-35689885 TAGCAGCACTTCTGACATCTTGG - Exonic
1117589909 14:57256527-57256549 GAGCAGCTCTTCTGACATTCTGG - Intronic
1118575448 14:67237857-67237879 GAACAGCCCTTCTGACAGGGGGG + Intergenic
1120313774 14:82865740-82865762 TAGCAGAACTTCTTACATGAAGG + Intergenic
1122341799 14:101033394-101033416 GAGCATCACTTCAGAGAAAATGG - Intergenic
1128989889 15:72250894-72250916 GAGCAGCCCTCCTGCCAAGGAGG - Exonic
1130717691 15:86351993-86352015 GGGCAGCACTTCTCACAGGAAGG - Intronic
1130964776 15:88689022-88689044 GAGCAGGACTTCTGAAAGGTCGG - Intergenic
1135648025 16:24180524-24180546 AGACAGCACTTCTGAAAAGACGG - Intronic
1136673876 16:31881426-31881448 GAGCACCACCTCTGAAGAGATGG - Intronic
1138263723 16:55644304-55644326 GAGCAGCCCTACTGAGAATAGGG + Intergenic
1138398242 16:56724624-56724646 GAGCATCACTTGAGACAAGGAGG - Intronic
1142129891 16:88427719-88427741 GAGCAGCACCCCTGGGAAGAGGG + Exonic
1144999262 17:19292113-19292135 CAGAAGCACTTCTGACACGCTGG - Intronic
1145911408 17:28545522-28545544 GAGCAGGGCTTCTGAGAAGTGGG - Intronic
1146788212 17:35736034-35736056 GAGCATCACTTAAGAGAAGAGGG - Intronic
1150200531 17:63352237-63352259 CATCAGCACTTATGACAAGGGGG - Intronic
1153581722 18:6580876-6580898 GAGCTGCATTTCTGAAAATATGG - Intronic
1153953663 18:10077378-10077400 GACCAGCAATTATGATAAGATGG - Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1156612835 18:38747888-38747910 GAGCATCACTTTGGACATGATGG + Intergenic
1156935750 18:42704870-42704892 AAACAGAACTTCTGCCAAGAAGG + Intergenic
1159231451 18:65612200-65612222 AAACAGCACTTCTGACTAGCAGG - Intergenic
1159848339 18:73494208-73494230 GAGCTGAACTTCTTACAAGGTGG - Intergenic
1166209765 19:41298789-41298811 GAGAAGCAATGCTGCCAAGACGG - Intronic
1167895101 19:52574196-52574218 GATCAGCATTTCTGAAAGGAAGG - Intronic
1167995435 19:53398064-53398086 GGTCAGCATTTCTGAAAAGAAGG - Intronic
925674506 2:6346687-6346709 CATTAGCACTTTTGACAAGATGG + Intergenic
926360195 2:12079577-12079599 GAGGAGCCCTCCAGACAAGAGGG - Intergenic
928078579 2:28287959-28287981 GAGAAGCACTTGGGACAGGAGGG + Intronic
931680324 2:64741646-64741668 GAGCAGCCCTGCCTACAAGATGG - Intronic
932837116 2:75048178-75048200 CAGCTGCACTTCTGGGAAGAGGG - Exonic
937285387 2:120747680-120747702 GAGCAGCACTGCTGACATTTGGG - Intronic
939787371 2:146533892-146533914 GAGCAGCACTACTGACATTTTGG + Intergenic
941179768 2:162244982-162245004 GGGCAGAACTTCTGAGAACACGG - Intronic
941389091 2:164889666-164889688 AAGCAGGAATTATGACAAGAAGG + Intergenic
942414676 2:175746374-175746396 GAGCAGCAGTTCTCAAACGAGGG + Intergenic
943918039 2:193663350-193663372 GTTCAGTACTACTGACAAGATGG + Intergenic
945458949 2:210082021-210082043 GAGCATCACTTGAGCCAAGAAGG - Intronic
946796506 2:223359970-223359992 GAGAAGCACTTCTGGAAAGCTGG - Intergenic
947489226 2:230579408-230579430 GAGAACCAGGTCTGACAAGATGG - Intergenic
1170743386 20:19077624-19077646 GGGCAACACTTCCGACAATAAGG + Intergenic
1171326842 20:24302186-24302208 GAGCATCAATTCTGGCTAGATGG + Intergenic
1173979295 20:47210847-47210869 GAGCAGCAGTGATGAGAAGAGGG - Exonic
1175632632 20:60555191-60555213 CATGAGCCCTTCTGACAAGAGGG - Intergenic
1175638124 20:60602551-60602573 GAGGAGCAGTTCTCAGAAGAAGG + Intergenic
1178234401 21:30824560-30824582 TAGCAGAAATTGTGACAAGAGGG + Intergenic
1183511848 22:38240140-38240162 GAGGAGCGCTTCTAACAAGAAGG + Intronic
1184891073 22:47379531-47379553 GAGCACAAGTTATGACAAGATGG + Intergenic
949586962 3:5450474-5450496 GAGCAGCAATTTTAAAAAGAAGG - Intergenic
954099240 3:48356696-48356718 GAGCTGAACTTGTGACCAGAGGG + Intergenic
954638354 3:52083794-52083816 GAGCATCAACTCTGACAGGAAGG + Intronic
955834241 3:63036704-63036726 GAGAAGCAGATCTTACAAGAAGG - Intergenic
957228847 3:77485170-77485192 GAGAACCCCTTCTGAAAAGAGGG - Intronic
957981606 3:87518665-87518687 GAGAAGCACTTCTTACATGGTGG - Intergenic
959067860 3:101676423-101676445 GAGCCGCACTTCCCACAGGAAGG - Intronic
960916494 3:122700913-122700935 GAGAAGCACTTCTGCCCAGCGGG - Exonic
963553400 3:146754221-146754243 GAACGGCACTTCTTACATGATGG + Intergenic
964190097 3:153991640-153991662 GAGAAGCACTTCTTACATGGTGG - Intergenic
966293950 3:178395844-178395866 GAGCAGAACCTGTGACATGAAGG - Intergenic
966959790 3:184923814-184923836 GTGCAGAAATTCTGACAAGGGGG - Intronic
967538057 3:190630258-190630280 GAGCAGCACTTCTGACAAGAAGG - Intronic
967728963 3:192889184-192889206 GAGAAACCCTTCTGACAAAAGGG + Intronic
969265181 4:6059771-6059793 CAGCAGCACTTCTGACACAGAGG + Intronic
969358681 4:6647370-6647392 GAGCACCATTTTGGACAAGAGGG + Intergenic
970701789 4:18750119-18750141 GAGGAGCACATCTTACATGATGG + Intergenic
971796385 4:31234206-31234228 GAACAGCATTTTTGAAAAGAGGG + Intergenic
972722037 4:41709431-41709453 GAGTAACTCTTCTGAAAAGAGGG + Intergenic
974877889 4:67720208-67720230 CAGCAGCACTTTGGACAGGATGG + Intergenic
975052923 4:69888430-69888452 GAAGAGCATTTCTGAAAAGAGGG - Intergenic
979192174 4:117875304-117875326 CTGCAGGACTTCTGAGAAGAAGG + Intergenic
984176342 4:176422844-176422866 GGGCAGAACTTCTGCCAGGATGG - Intergenic
984897437 4:184554029-184554051 GAGCAGCAGATCTGAGCAGAAGG - Intergenic
985063815 4:186103117-186103139 GAGCAGCAATGGTAACAAGAGGG - Intergenic
985383392 4:189419485-189419507 GAGGAGCACTTCAGGGAAGACGG + Intergenic
988901760 5:35740456-35740478 TAGCAACACTTCTGGAAAGAGGG + Intronic
990321078 5:54630450-54630472 AAGCAGCACTTTCGCCAAGATGG - Intergenic
993704181 5:91150869-91150891 GGGCAGCATTACTGACAAGCTGG - Intronic
996542235 5:124642613-124642635 GAGCAGCACATCTGCCTAGATGG + Intronic
1000026818 5:157366234-157366256 GACCAGCACTTCACAAAAGATGG - Intronic
1000241158 5:159409430-159409452 TAGCAGCACTGTTGACAAAATGG + Intergenic
1003202744 6:3977282-3977304 AAGCAGTGCTTCTGGCAAGATGG + Intergenic
1016077911 6:139819474-139819496 TACCAGCACTTCTCACAGGAGGG + Intergenic
1016822012 6:148355746-148355768 GAGCAGCACTTCTTAGATTAAGG - Intronic
1018498704 6:164379036-164379058 TAGCAGGCCTTCTGCCAAGAGGG + Intergenic
1022810514 7:33863442-33863464 GAGGAGTAGTGCTGACAAGAAGG - Intergenic
1022834799 7:34103177-34103199 GAGCAGTACTTCTGGGAATAGGG + Intronic
1024757156 7:52547799-52547821 GAGCAGGACTTCTGAAAGGTTGG - Intergenic
1024789495 7:52948387-52948409 CATCAGCACTTCTGACTAGTTGG - Intergenic
1025231302 7:57204765-57204787 GAGAACCACTTCTGACTAGAAGG + Intergenic
1027150699 7:75731542-75731564 GAGCAGCTCTCCTTGCAAGAAGG + Intronic
1027487942 7:78785477-78785499 AGGCAGCACCTCTGACATGATGG - Intronic
1028604991 7:92645650-92645672 GAGCAGCAGTGCTGCCCAGATGG - Intronic
1030522241 7:110612139-110612161 TAGCTGCACTTCCTACAAGAAGG - Intergenic
1032537634 7:132678024-132678046 CCACTGCACTTCTGACAAGACGG + Intronic
1033611824 7:142970615-142970637 CACCAGCACCTCTGACAGGAGGG - Intergenic
1037576132 8:20204905-20204927 GAGAAACACTTCTTAAAAGAAGG + Intronic
1038676885 8:29630927-29630949 GAGCAGCAAATCTTAAAAGAAGG + Intergenic
1039974351 8:42348464-42348486 GAGCAGCGCTTCTTAGAACAAGG + Intronic
1043508947 8:80931179-80931201 GTGCAGCACTTCTGAAACCATGG + Intergenic
1056087929 9:83172248-83172270 AAGCATCTTTTCTGACAAGAAGG - Intergenic
1056533176 9:87505299-87505321 AAGCCACTCTTCTGACAAGAGGG + Intronic
1057466898 9:95322445-95322467 AGGCAGCACTTCTTACATGAGGG + Intergenic
1058493019 9:105522638-105522660 TAGCAGCACTTCTGACATCTTGG + Intronic
1060664752 9:125426153-125426175 GGGCACCGCTTCTGCCAAGATGG - Intergenic
1187821455 X:23292649-23292671 CAGCAGCATTTCACACAAGAGGG - Intergenic
1187935744 X:24334252-24334274 TACCAGCACTTCTGACTAGCTGG + Intergenic
1188076122 X:25777148-25777170 GAGCAGCACTTCAGCAAACATGG + Intergenic
1189757369 X:44284629-44284651 GAGCAGCTCCTGTGACAAGAGGG + Intronic
1190639928 X:52474570-52474592 GAGCAGAACTCCTGAAAAGGTGG - Intergenic
1190647744 X:52538295-52538317 GAGCAGAACTCCTGAAAAGGTGG + Intergenic
1192767718 X:74159638-74159660 GAAAAGCACTTCTTACAAAAGGG + Intergenic
1199524008 X:148771110-148771132 GAGCAGAACTTCTCATGAGATGG + Intronic