ID: 967539967

View in Genome Browser
Species Human (GRCh38)
Location 3:190656053-190656075
Sequence CCCCTTGAGCACCCGCACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967539960_967539967 20 Left 967539960 3:190656010-190656032 CCAGAACTCCATTGCCACCAAGC 0: 1
1: 0
2: 3
3: 15
4: 136
Right 967539967 3:190656053-190656075 CCCCTTGAGCACCCGCACCCAGG 0: 1
1: 0
2: 1
3: 9
4: 142
967539961_967539967 12 Left 967539961 3:190656018-190656040 CCATTGCCACCAAGCTCATTGTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 967539967 3:190656053-190656075 CCCCTTGAGCACCCGCACCCAGG 0: 1
1: 0
2: 1
3: 9
4: 142
967539963_967539967 6 Left 967539963 3:190656024-190656046 CCACCAAGCTCATTGTGGTTGAG 0: 1
1: 0
2: 1
3: 6
4: 101
Right 967539967 3:190656053-190656075 CCCCTTGAGCACCCGCACCCAGG 0: 1
1: 0
2: 1
3: 9
4: 142
967539964_967539967 3 Left 967539964 3:190656027-190656049 CCAAGCTCATTGTGGTTGAGTAC 0: 1
1: 0
2: 0
3: 4
4: 99
Right 967539967 3:190656053-190656075 CCCCTTGAGCACCCGCACCCAGG 0: 1
1: 0
2: 1
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967539967 Original CRISPR CCCCTTGAGCACCCGCACCC AGG Exonic
900606967 1:3528023-3528045 GCGCTTCAGCACCCCCACCCAGG - Intronic
900813623 1:4826664-4826686 CCCCATGAACACCCCCGCCCAGG - Intergenic
902515143 1:16986072-16986094 CCCCGAGACCACCCCCACCCTGG - Exonic
902735724 1:18399400-18399422 CCCCGGGAGCACCAGCAGCCAGG - Intergenic
907445974 1:54507930-54507952 CTCCCTCAGCACCCCCACCCAGG - Intergenic
907982025 1:59492530-59492552 CCCCTTGAACTCCAGCAGCCAGG - Intronic
912951042 1:114120810-114120832 CCCCTGGGGCACCTGCACTCAGG + Intronic
914913069 1:151802143-151802165 CAAGTTGAGCACCCTCACCCTGG - Exonic
915835517 1:159172414-159172436 CCCCTTCAGCAGCCTCACCCAGG - Intronic
918070262 1:181129105-181129127 CCCTTTGAGCTCTCGTACCCAGG - Intergenic
919739004 1:200971439-200971461 CCCCTTGAGCTCCCACCCCCGGG - Intronic
920449764 1:206051110-206051132 CCCCTTGGCCACCCACACCCAGG + Intronic
920574682 1:207050809-207050831 GCCCTGGAGTTCCCGCACCCGGG + Exonic
921313966 1:213873341-213873363 CACCTTCAGCACCAGCCCCCTGG + Intergenic
922222817 1:223621415-223621437 TTCCCTGAGCACCCGCTCCCTGG - Intronic
922455455 1:225770459-225770481 CCCCTGCAGCACCCCCACCCAGG + Intergenic
922566557 1:226605221-226605243 CCCCAAGAGCAGCCTCACCCAGG + Exonic
923542324 1:234897447-234897469 CCCCTTGAGCCCCCTCCCCCTGG - Intergenic
1067804800 10:49385176-49385198 CCCCCAGAGCACCTGGACCCTGG + Intronic
1072638918 10:97196339-97196361 CCCCTTGCGCTCCCTCCCCCGGG - Intronic
1074377753 10:112952625-112952647 CTCCTTGAGCCCGCACACCCTGG - Intronic
1074896901 10:117784981-117785003 CCCCTTGAGCACCCAGGCCTGGG + Intergenic
1076499097 10:130921720-130921742 CCCCTTCAGCACCTGCATCAAGG + Intergenic
1076735216 10:132455942-132455964 GACCCTGAGCACCAGCACCCTGG - Intergenic
1077232702 11:1465167-1465189 CCTCTTGTGCACCTGCCCCCAGG + Intergenic
1081537323 11:44005244-44005266 CCCATTCAGCACCCCCTCCCCGG + Intergenic
1082203777 11:49405936-49405958 ACCCTGGAGCGCCCGCACTCTGG + Intergenic
1083596848 11:63921722-63921744 CCTCTTGAGCACCCCCAGCAGGG + Intergenic
1084743361 11:71153120-71153142 CCCCGTGAGGACCAGCACGCCGG + Intronic
1085396750 11:76210346-76210368 CCCCTTGGGCACCCACTCCCGGG - Intronic
1088442539 11:109887767-109887789 CCCCTTGACCACTCCTACCCTGG - Intergenic
1096660165 12:53119201-53119223 GCCCTTCAGCACCCGTGCCCTGG + Exonic
1104033899 12:125085070-125085092 CCCCTACACCACCCCCACCCCGG - Intronic
1105890611 13:24680347-24680369 CCCCTAGAGACCCCGCCCCCTGG + Intergenic
1109427489 13:62184750-62184772 CCCCTTGACAACCCCAACCCTGG - Intergenic
1113677382 13:112215998-112216020 GCCCTGGAGCACCCGGACCTCGG - Intergenic
1113923145 13:113925720-113925742 CCCCTTAAGCACACGCCCCATGG + Intergenic
1115956751 14:38789749-38789771 CCTCTGGTGCACCAGCACCCTGG + Intergenic
1117899313 14:60515812-60515834 CCCCTTTAGGTCCCGCTCCCTGG - Intergenic
1121047164 14:90796497-90796519 CTCCTTGATCCCCCCCACCCGGG + Intronic
1121493920 14:94378950-94378972 CTCCTTGAGGACACGGACCCTGG + Intronic
1121751950 14:96364222-96364244 GCCATAGAACACCCGCACCCAGG - Exonic
1122838159 14:104441439-104441461 CCCTTGGAGCACCCTCCCCCAGG - Intergenic
1124987527 15:34636217-34636239 CCCCTGGATGACCCCCACCCAGG - Intergenic
1125426235 15:39552479-39552501 CAGCTTGAGCACCAGCTCCCTGG + Intergenic
1125505488 15:40265532-40265554 CCCCCTGAGCTCCAGCTCCCTGG + Intronic
1125591560 15:40857517-40857539 GCCCTTGATCAGCCCCACCCTGG + Exonic
1125750470 15:42024221-42024243 CTGCTTTGGCACCCGCACCCTGG - Intronic
1128054753 15:64691362-64691384 CCCCTTGAGCAGCAGCACAGTGG + Intronic
1132481111 16:166512-166534 CCCCCAGAGCCCCCCCACCCCGG - Intronic
1133479936 16:6160481-6160503 CCCCTCCAGCACCATCACCCTGG + Intronic
1135491711 16:22915151-22915173 CTCCTTCCGCAACCGCACCCTGG + Exonic
1138394372 16:56692663-56692685 CCCCTCCAGCACACCCACCCCGG + Intronic
1142558721 17:797180-797202 TCCCTTGCGCAGCCGCAGCCTGG + Intergenic
1143117097 17:4587272-4587294 CCCCTTGAGCCCTGGCTCCCGGG + Intronic
1143547112 17:7604012-7604034 TCCCTTCATCATCCGCACCCGGG + Exonic
1145302087 17:21647956-21647978 GCCCTTGAGCACAGCCACCCAGG - Intergenic
1145348223 17:22055360-22055382 GCCCTTGAGCACAGCCACCCAGG + Intergenic
1145737253 17:27241526-27241548 CCCCTTTCTCACCCCCACCCAGG - Intergenic
1146546938 17:33748196-33748218 CTCCTTAAGCACCCGCCTCCTGG + Intronic
1147140911 17:38460201-38460223 CCCCTTGACACCCTGCACCCAGG + Intronic
1147218243 17:38913151-38913173 CACCTTGACCACCACCACCCAGG - Intronic
1147336657 17:39730373-39730395 CGGCTGGAGGACCCGCACCCTGG - Intronic
1147339498 17:39745319-39745341 CCCCTTGGGCACACTCACCAAGG - Exonic
1150711307 17:67532889-67532911 CCCTTTGAGGACCCTCACCATGG + Exonic
1151411363 17:73932400-73932422 CCCCTTGAACACCCACTGCCCGG + Intergenic
1151421137 17:73998756-73998778 CCCCTGGATCACCCGTGCCCTGG - Intergenic
1151927840 17:77211844-77211866 CAGCTTCAGCACCTGCACCCTGG + Intronic
1152004574 17:77672035-77672057 CACCTCCAGCACCCCCACCCTGG + Intergenic
1152095635 17:78270056-78270078 CCCCCTGAGCCCCTGCAGCCTGG - Intergenic
1152226729 17:79096245-79096267 GCCCTGGAGCACAGGCACCCAGG + Intronic
1152379447 17:79934824-79934846 CCCCTCCAGCCCCCGCCCCCAGG + Exonic
1152538789 17:80964553-80964575 CCCACTGAGCACCAGCATCCAGG + Exonic
1160618994 18:80156850-80156872 CACATTGAGCACCAGCATCCTGG - Intronic
1160918367 19:1508267-1508289 CCCCTTAGGCACCCACTCCCGGG - Intronic
1162019862 19:7863419-7863441 GCCCTTCAGCAGCCGCACCTGGG - Exonic
1164579864 19:29428129-29428151 CCCCCAGAGCACACGCAGCCTGG + Intergenic
1166989289 19:46681578-46681600 CCCCTTCCCCACCCCCACCCCGG + Intronic
1167538258 19:50069127-50069149 CTTCTTGGGCACCAGCACCCAGG - Intergenic
1168132767 19:54331820-54331842 CCTCCTGAGCTCCCCCACCCAGG - Intergenic
1168694155 19:58395597-58395619 CCGGTTGAGCACCCTCCCCCTGG + Intergenic
925085310 2:1103016-1103038 ACCCTGGAGCCCCCGCCCCCTGG + Intronic
925103917 2:1272800-1272822 CCCTTTCTGCACCCGCTCCCTGG - Intronic
925198602 2:1947978-1948000 CTCTTTGAGCACCCGGACTCCGG + Intronic
925870791 2:8268543-8268565 TCCCTTGAACACCCACTCCCGGG + Intergenic
926083985 2:10009823-10009845 CCCCTTCAGCCATCGCACCCTGG + Intergenic
927285881 2:21356279-21356301 CCTCCTGAGGACCCCCACCCCGG - Intergenic
927932050 2:27051724-27051746 CACCTTGGGCCCCGGCACCCGGG - Exonic
937395312 2:121530058-121530080 CCCCCTAAGCACTCGCAGCCTGG - Intronic
1169117663 20:3076291-3076313 CCCCTTAGGCACCCGCCCACTGG + Intergenic
1170708034 20:18763567-18763589 CCACATGCGCACCCGCCCCCTGG - Exonic
1171429884 20:25076317-25076339 CTCCTTGAGCACCAGCCCCAGGG + Exonic
1171518672 20:25759384-25759406 GCCCTTGAGCACAGCCACCCAGG - Intergenic
1171558181 20:26096825-26096847 GCCCTTGAGCACAGCCACCCAGG + Intergenic
1172229493 20:33327212-33327234 CCCCTTGACCCCCAGCCCCCAGG - Intergenic
1175536023 20:59713404-59713426 CCCCTTGTGTACCCCCACCCAGG + Intronic
1175561576 20:59934197-59934219 GCCCTCCGGCACCCGCACCCAGG - Intronic
1178327446 21:31657330-31657352 CCACTTGAGTACCCGGATCCTGG - Intergenic
1179816416 21:43909142-43909164 CCCTTGGAGCACCCAGACCCGGG - Intronic
1180626032 22:17194171-17194193 CTCCTTGAACCCCCGCCCCCAGG - Intronic
1181313842 22:21959762-21959784 TGCCCTGAGCACTCGCACCCAGG + Intronic
1181343092 22:22198541-22198563 TCTCTTGAGCACCTGCACCATGG + Intergenic
1181865587 22:25852062-25852084 TCCATTCAGCACCAGCACCCTGG + Intronic
1182490333 22:30667669-30667691 GCCCCTGAGCAGCCCCACCCTGG + Exonic
1183386198 22:37516174-37516196 CTCCTCGAGCACCCGGCCCCGGG + Exonic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184510382 22:44929938-44929960 CCCCTGCAGCACCTGCAACCAGG + Intronic
1184523563 22:45009123-45009145 CCCCTCGGGCCCCCGCGCCCCGG - Intronic
1184596815 22:45518909-45518931 CCACTGCAGCACCCGCAGCCTGG - Intronic
1184815698 22:46867890-46867912 TCCCTAGAGCACCCGCTTCCTGG + Intronic
1185322717 22:50209308-50209330 CCCCTGGAGCAGCTGCAGCCAGG + Intronic
1185399887 22:50610323-50610345 CCCATTCTGCACCCACACCCTGG - Intronic
949490920 3:4588103-4588125 CCCCTTAAGCACCCCCACTGAGG + Intronic
953983960 3:47427325-47427347 CCCCTTTCTCACCCCCACCCTGG + Intronic
957261642 3:77909547-77909569 CCCCTTTAGGACACTCACCCCGG - Intergenic
961826415 3:129601547-129601569 CCCCATGTGCAGCCCCACCCAGG + Intronic
964537392 3:157738850-157738872 TCCCTTTACCACCCGCAGCCCGG + Intergenic
965590864 3:170358406-170358428 CCCCTTGCACACCCACCCCCAGG + Intronic
967224348 3:187276549-187276571 CCCCATGTGCACCCACACCTGGG + Intronic
967539967 3:190656053-190656075 CCCCTTGAGCACCCGCACCCAGG + Exonic
967985809 3:195094653-195094675 GGCCTCGAGCACCCGCATCCAGG - Intronic
968505160 4:968063-968085 CACCTGGTGCCCCCGCACCCTGG - Intronic
968579646 4:1383981-1384003 CCCCTCGAACACCCTCACACGGG - Intronic
975166771 4:71186789-71186811 TTCCGTGAGCCCCCGCACCCCGG + Intergenic
976897404 4:90128247-90128269 CCGCCTCAGCACCCGCAGCCCGG - Intronic
985536722 5:469211-469233 CCCTCTGAGCACCAGGACCCAGG - Intronic
985672123 5:1212502-1212524 CCTCTGGAGCACCTGCAGCCTGG - Intronic
997126138 5:131228803-131228825 TCCCTTGAGCACATGCACCAAGG + Intergenic
1003532595 6:6950217-6950239 CCCCTTGAGCACTTGAGCCCAGG - Intergenic
1004614802 6:17280521-17280543 CTCCTTGACCCCCCGCGCCCGGG + Intergenic
1011156556 6:84340338-84340360 ATCCTTGAGCACCCACAACCAGG - Intergenic
1013771643 6:113634512-113634534 CCCATTTAACACCCGGACCCAGG - Intergenic
1018845409 6:167552039-167552061 CCCCTTGAGCAAGGGCTCCCAGG + Intergenic
1019166020 6:170098050-170098072 CCCCATGAGCACACACACCCAGG + Intergenic
1019613425 7:1948182-1948204 CCCCTCCAGCACACGCACCATGG + Intronic
1019714047 7:2530233-2530255 CCCCCTGACCTCCAGCACCCGGG - Intergenic
1020106080 7:5422982-5423004 CCCCTGGAACACCCTCACACTGG + Intronic
1023770695 7:43554079-43554101 CCCCTTGAGCAGCTGCTCTCAGG - Intronic
1025279165 7:57614501-57614523 GCCCTTGAGCACAGCCACCCAGG - Intergenic
1025305566 7:57850999-57851021 GCCCTTGAGCACAGCCACCCAGG + Intergenic
1025818544 7:64942739-64942761 CAGCCGGAGCACCCGCACCCAGG + Intergenic
1028922377 7:96322169-96322191 CCGCTGGATCACGCGCACCCCGG - Intergenic
1029730003 7:102433150-102433172 CCCCTTTTGCGCCCGGACCCAGG + Intronic
1032463187 7:132126743-132126765 CCCCTTGTGCACCCGCAGCCTGG - Exonic
1035566380 8:643948-643970 CCCCCTGAGCACCAGCACGGTGG + Intronic
1049812408 8:144581432-144581454 GCTCCTGAGCACCCGCAACCGGG + Intronic
1056313719 9:85368667-85368689 CCCCATGTGCCCCTGCACCCTGG + Intergenic
1056817485 9:89812109-89812131 CCCCATGCCCACCTGCACCCAGG + Intergenic
1057125447 9:92612622-92612644 CACCTAGAGCAGCCACACCCAGG - Intronic
1057150836 9:92794453-92794475 CCCCTTGAGCCTCAGCAACCAGG - Intergenic
1061424684 9:130491579-130491601 CCCCTTGATCACGAGCATCCTGG - Intronic
1203785326 EBV:124390-124412 CCCCTTGAGCACGCTCTCCCCGG + Intergenic
1198268531 X:135032743-135032765 TCCCCAGAGCACCCGCCCCCAGG - Exonic