ID: 967539999

View in Genome Browser
Species Human (GRCh38)
Location 3:190656293-190656315
Sequence CAGAGCTCAGAGAGGGCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 1, 2: 2, 3: 51, 4: 521}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967539999 Original CRISPR CAGAGCTCAGAGAGGGCTGC AGG Exonic
900804133 1:4756273-4756295 AGCAGCTCAGGGAGGGCTGCAGG + Intronic
900804578 1:4758989-4759011 CAGAGCTCAGGTCGGGATGCAGG + Intronic
902081618 1:13824828-13824850 CAGAGCTCACCATGGGCTGCAGG - Exonic
902236385 1:15060197-15060219 CGGAGATGACAGAGGGCTGCCGG - Exonic
902393638 1:16120344-16120366 CAGAACCCAGAAAGGGCTGCAGG + Intergenic
902824722 1:18965146-18965168 CTCTGCTGAGAGAGGGCTGCAGG - Intergenic
902924356 1:19686123-19686145 CAAAGCCCAGAGAGGGGTGGCGG + Intronic
902996421 1:20229004-20229026 CAAAGCTAAAAGGGGGCTGCTGG + Intergenic
903333918 1:22612584-22612606 GGGAGCTGAGAGAAGGCTGCGGG - Intergenic
903848032 1:26290052-26290074 CAGGGGCCAGAGAGAGCTGCAGG - Intronic
903851139 1:26306794-26306816 CACCGCTCTGAGAGGGCTCCAGG + Intronic
904383040 1:30124385-30124407 CAGAGCTGTCAGAGGCCTGCAGG + Intergenic
905110389 1:35590420-35590442 CTGAGCTCAGAGATGGGAGCTGG - Intronic
905232521 1:36523126-36523148 CCGAGCACAGAGAGAGATGCAGG - Intergenic
906222061 1:44088540-44088562 CAAGGCTGAGAAAGGGCTGCAGG - Intergenic
906322577 1:44826398-44826420 CAGGGCTCACAGAGGGCTCCTGG + Intronic
906529950 1:46518074-46518096 CATAGCTCATAGAAAGCTGCAGG + Intergenic
907219940 1:52899086-52899108 CAGAGCTCAGACAGCACAGCTGG - Intronic
907328981 1:53659124-53659146 CAGAGCACTCAGAGGGCTTCAGG - Intronic
907762820 1:57378121-57378143 CAGAGCTCAGAGCAGGATGGAGG + Intronic
908639307 1:66204462-66204484 CACAGCTCAAGGAGGCCTGCCGG - Intronic
910226144 1:84938630-84938652 CAGAGCAAAGACAGGCCTGCAGG + Intronic
911086111 1:93978703-93978725 CAGAGCAGAGGGAGGGGTGCTGG - Intergenic
911165250 1:94719168-94719190 CAGACCTATGTGAGGGCTGCTGG + Intergenic
911282892 1:95953242-95953264 AAGAGCCCAGAAAGGGCTGGGGG + Intergenic
911450347 1:98053914-98053936 GAGAGCTCGGCCAGGGCTGCGGG - Intergenic
911648525 1:100360888-100360910 GAGAGCTCCAAGTGGGCTGCAGG + Intronic
912270040 1:108199910-108199932 CTGAGCGTAGGGAGGGCTGCGGG - Intronic
913609619 1:120497332-120497354 ACGAGCTCTGAGAGGGCAGCTGG - Intergenic
913719221 1:121574802-121574824 CACAGCTCAAGGAGGCCTGCCGG + Intergenic
914086769 1:144461194-144461216 CAGCGCCCAAGGAGGGCTGCGGG + Intronic
914581571 1:149024512-149024534 ACGAGCTCTGAGAGGGCAGCTGG + Exonic
915312089 1:155009954-155009976 CGGAGTTCAGGGAGGGCTGAAGG + Intronic
915581563 1:156816097-156816119 GTGAGCACAAAGAGGGCTGCCGG + Intronic
915594583 1:156888776-156888798 AAGGGCTCACAGAGGGCAGCTGG - Intergenic
915638399 1:157202640-157202662 CTGAGCTCAGAGAGGCCAGGTGG - Intergenic
915658493 1:157381318-157381340 CTGAGCTCAGAGAGGCCAGGTGG - Intergenic
916323635 1:163533390-163533412 CAGAACCCAGAGAGAGCTTCAGG - Intergenic
918303865 1:183228370-183228392 CAGAGCTCACAGCGGGCACCTGG - Exonic
918780148 1:188689746-188689768 CAGACCTCACAGATGGCAGCTGG + Intergenic
919149782 1:193681157-193681179 CAGAGCTCTGAGAGAACAGCAGG - Intergenic
919797207 1:201328079-201328101 CAGAGCTCAGGGCTGGCAGCAGG + Intronic
919896485 1:202012602-202012624 GAGAACTCAGAGAGGGCTCAGGG - Intronic
920106788 1:203559120-203559142 CTGGCCTCAGAGATGGCTGCAGG - Intergenic
920498320 1:206470860-206470882 CAGAGCCCAGGGAGGGCTTGTGG - Intronic
920500386 1:206481592-206481614 CAGGGCACAGAGGGGGCTCCAGG + Intronic
920529962 1:206694658-206694680 CAGAGCTCAAAGGGTCCTGCGGG + Intronic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
921969076 1:221125251-221125273 AAGAGCTCAGAAAGGAATGCAGG - Intergenic
922088188 1:222370673-222370695 CAGAGGAGAGAAAGGGCTGCAGG + Intergenic
922224240 1:223631490-223631512 AAGAGGTCAGAGAGGGATGAGGG - Intronic
922472206 1:225883295-225883317 CAGAGCTCAGAGAGGGGTGCTGG - Intergenic
922619218 1:226980158-226980180 CAGAGCTCAGCCAGGGTGGCCGG - Intronic
922936550 1:229427180-229427202 CAGAGCACACTGGGGGCTGCTGG - Intergenic
923016428 1:230130063-230130085 CAGAGACAAGAGAGGACTGCAGG - Intronic
923161147 1:231316029-231316051 CAGAGCCCAGGGAGGGCTGGAGG + Intergenic
923516806 1:234704514-234704536 CTGCGCTCACAGAGGGCTGGAGG + Intergenic
924052826 1:240093788-240093810 CAGAGCCCAGGGAGGGCGGGTGG - Intronic
924710623 1:246527627-246527649 CAGCTCACAGAGAGGGCCGCTGG + Intergenic
1063107878 10:3009362-3009384 CAGAGCCCAGCGGGGGCAGCAGG + Intergenic
1063391078 10:5650187-5650209 CAGTGCTCAGAGTAGGCTGGTGG - Intronic
1063673758 10:8121323-8121345 CGGAGGTCAGAAAGAGCTGCAGG + Intergenic
1063796146 10:9516059-9516081 ATGAGCTCACAGAGGCCTGCTGG - Intergenic
1064840554 10:19586720-19586742 CACAGCTCAAGGAGGCCTGCGGG - Intronic
1065113839 10:22465134-22465156 CACAGCTCAGGTAGGGCTGCTGG - Intergenic
1066503595 10:36019236-36019258 CAGAGCTCAGGGAGTAATGCTGG - Intergenic
1067912050 10:50355840-50355862 CACATCTCAGACAGGGCGGCGGG - Intronic
1069212465 10:65779272-65779294 AAGAGCTCAGGGAGGGAGGCTGG + Intergenic
1069737799 10:70669011-70669033 CAGTGTCCACAGAGGGCTGCTGG + Intergenic
1069833628 10:71295671-71295693 AAGAGCTCACAGAGGGCTTATGG - Intronic
1069903155 10:71717360-71717382 CTGAGCTCCGAAAGGGCTGGGGG - Intronic
1070650467 10:78231834-78231856 CTGAGCTCAGAGAATTCTGCAGG - Intergenic
1070707054 10:78647406-78647428 CAGACCTCAGAGAGGATGGCTGG + Intergenic
1070731269 10:78830157-78830179 GAGAGCTTAGAGAGGGCAGAAGG - Intergenic
1070814646 10:79315101-79315123 CTGAGCCCAGAGATGGTTGCAGG - Exonic
1071521212 10:86332428-86332450 CAGAGCTCCCAGGGGTCTGCTGG + Intronic
1071587827 10:86842385-86842407 CAGAGCCCAGAGCGGGGTGGAGG + Intronic
1073448825 10:103597384-103597406 CTGGGGTGAGAGAGGGCTGCTGG + Exonic
1074061372 10:109969172-109969194 CAGAGATCAGAGCTGGCAGCAGG + Intergenic
1074116346 10:110459995-110460017 CAGAGCTCAGCCATGGCTTCTGG + Intergenic
1074118546 10:110476186-110476208 CAGGGCCCAGAGTGAGCTGCAGG - Intergenic
1075207724 10:120461592-120461614 AAGAGCTCAAAGAAGGATGCTGG - Intronic
1075472579 10:122703994-122704016 CAGAGCCCAGGGATGGCTGCAGG - Intergenic
1076369913 10:129945612-129945634 CAGAGATAAGAGAGAGCTCCGGG - Intronic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076675145 10:132143819-132143841 CGGAGCCCACAGAGGGCTGTGGG - Intronic
1077200182 11:1302859-1302881 GAGTGCTCAGCGAGGGCTCCTGG - Intronic
1079119735 11:17673337-17673359 CAGGGCTCAGAGAGAGATGGAGG - Intergenic
1079326104 11:19494028-19494050 CAGAGCTCAGTCTGGTCTGCAGG - Intronic
1081739534 11:45428614-45428636 CAGAGGTCAGGGAGGGTTGCCGG - Intergenic
1082835820 11:57649508-57649530 CAGAGCTTGGAGAGGGATGGAGG + Exonic
1083274346 11:61588266-61588288 CGGAGCTCAGTAAGTGCTGCCGG - Intergenic
1084110375 11:67010488-67010510 CAGAGCCCAGGGAGGGGTGGGGG - Intronic
1084445319 11:69200371-69200393 CAGATCTGACAGAGGGCTCCCGG + Intergenic
1084469141 11:69345094-69345116 CTGAGCTCAGAGAGGGCTCAGGG + Intronic
1084860689 11:72015987-72016009 CAGAGGTCAGAGAGGCCACCTGG + Exonic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1088195032 11:107264566-107264588 CACAGCTCATAAATGGCTGCCGG - Intergenic
1088521950 11:110711253-110711275 CAAAGCTGGGAGAGGGATGCAGG - Intronic
1089129129 11:116198730-116198752 GAGACCTGAGAGAGGGATGCAGG - Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089326864 11:117663428-117663450 AAGAGCTCCCAGAGGGATGCTGG - Intronic
1089659103 11:119974373-119974395 CAGGGCTCAGAGAAGACAGCAGG - Intergenic
1090320431 11:125838529-125838551 AAGATCCCAGAGAGAGCTGCAGG + Exonic
1090386597 11:126360977-126360999 CAGACCTCAGAGAGGCAGGCAGG + Intronic
1090478351 11:127045618-127045640 CAGAGCCCAGAGGTGGCAGCAGG - Intergenic
1090650094 11:128798920-128798942 CAGAAGACAGAGAGGGCTGATGG - Intronic
1091391999 12:131369-131391 CAGAGAGCAGAGAGAGGTGCGGG - Intronic
1091660313 12:2378345-2378367 CAGAGGCCATAGAGGGGTGCTGG - Intronic
1091775656 12:3183116-3183138 AAGTGCTCAGAGAAGGCTTCTGG + Intronic
1091799533 12:3316220-3316242 CAGCACCCAGAGAGGGCAGCAGG + Intergenic
1094132645 12:27091104-27091126 GAGAGCTAGGAGAGGACTGCAGG - Intergenic
1094465778 12:30753433-30753455 CAGAACTCAGAGTAGACTGCAGG + Exonic
1096757934 12:53815612-53815634 CTGAGTTCAGAGGGGGCTGAGGG + Intergenic
1097357730 12:58620963-58620985 CAGAGATCAGACAGTGCTGTGGG - Intronic
1097688572 12:62713375-62713397 GAGAGCTGAAAGAAGGCTGCTGG + Intronic
1097694730 12:62765127-62765149 CAGAGCTGAGAGAGGGAACCAGG + Intronic
1098253826 12:68595932-68595954 TAGGGCTCAGAGAGGTCAGCAGG - Intergenic
1099750284 12:86764385-86764407 CACAGCTCAAGGAGGCCTGCCGG + Intronic
1100312576 12:93410943-93410965 CAAAGATCAGAGAGGTCTGTGGG - Intronic
1100663837 12:96729299-96729321 CACAGCTCAAGGAGGCCTGCCGG - Intronic
1100703372 12:97173821-97173843 CAGAGCTCAAAGAGGTTTGGAGG + Intergenic
1101364175 12:104056152-104056174 CAAAGCATAGAGAGGGCAGCTGG - Intronic
1101834950 12:108288596-108288618 CAGAGCGCACAGAGCCCTGCAGG - Exonic
1102282152 12:111626870-111626892 CATAGCTCAGTGAGCACTGCTGG - Intergenic
1102551250 12:113693769-113693791 CAGAGGTCAGACAGGGCTGATGG + Intergenic
1102784205 12:115591003-115591025 CAGAGCTCAAAGAGGAAAGCTGG - Intergenic
1102894299 12:116586337-116586359 CAAAGCTCAGAGAGGTCAACAGG - Intergenic
1103735903 12:123060723-123060745 TGGAGCTCAGAGAGGGTTCCAGG + Intronic
1103853937 12:123951602-123951624 AAGTGCACAGAGAGGGCAGCAGG - Intronic
1103993886 12:124816736-124816758 CGGAGCTCTGAGACGGCTGGCGG - Intronic
1104658277 12:130590508-130590530 CACTGATGAGAGAGGGCTGCGGG - Intronic
1104689357 12:130813714-130813736 CAGAGCCCAGGGAGGGTGGCAGG + Intronic
1104804214 12:131574633-131574655 CAGAGCTGAGCGGGGGTTGCTGG - Intergenic
1104804223 12:131574677-131574699 CAGAGCTGAGCGGGGGTTGCTGG - Intergenic
1105058102 12:133122237-133122259 CAGAGCTCAAAGTGGTCTGCAGG - Intronic
1105843106 13:24272513-24272535 GAGAGCTCTGAGAGGGCAGGGGG + Intronic
1106035061 13:26036661-26036683 CAAAGCTCAGAGAGGTCTCCTGG + Intergenic
1106080389 13:26495843-26495865 CAGAGCTTGGAGAGGACAGCTGG + Intergenic
1106345542 13:28873369-28873391 CAGGGTTCAGAGAAGGCTTCAGG - Intronic
1109679997 13:65739025-65739047 CAGAGATCAGGGAGGGTAGCAGG + Intergenic
1110046591 13:70840870-70840892 CAGAGCAGACTGAGGGCTGCTGG - Intergenic
1110506649 13:76295140-76295162 CACATCTCAGACAGGGCGGCGGG - Intergenic
1110909075 13:80932625-80932647 CAGAGCTCAGGGAGTAATGCAGG + Intergenic
1111656814 13:91164346-91164368 CAGAGCTAAGAGAACCCTGCAGG - Intergenic
1112195856 13:97225657-97225679 GAAAGCCCAGAGAGAGCTGCAGG + Intronic
1112248563 13:97756780-97756802 AAGGGATCAGAGAAGGCTGCCGG - Intergenic
1113221557 13:108109676-108109698 CAGAGCTTAGAAAGAGCTGATGG + Intergenic
1113891829 13:113740005-113740027 GAGAGCCCAGGGAGGGCAGCAGG - Intergenic
1113958605 13:114112914-114112936 CTTAGCTCAGGGAGGGCTGGAGG + Intronic
1114438329 14:22726443-22726465 CTGAGCCCAGAGAGGGGTGCCGG + Intergenic
1114484003 14:23052459-23052481 CAGAGCTCGGTGAGGACTCCAGG - Exonic
1114484115 14:23053026-23053048 CAGAGCTGTGACAGGGATGCTGG + Intronic
1114553139 14:23545717-23545739 CAGAACACAGAGATGGCTGGGGG + Intronic
1115348410 14:32366884-32366906 CACAGCTCAGAGGAGGCTGGGGG + Intronic
1115805230 14:37043442-37043464 GAGGGCTCACAGAGGACTGCAGG - Intronic
1115946130 14:38662974-38662996 CAGAGCTAAGAGAGTGCTCCAGG - Intergenic
1117819409 14:59632195-59632217 CAGAGCTCCCACAGGGCTGATGG + Intronic
1118595657 14:67433193-67433215 CAGAGCTGATGGATGGCTGCTGG + Intergenic
1118740710 14:68737483-68737505 CAGAGGTGAGAGAGGGCATCAGG - Intergenic
1119489927 14:75022750-75022772 CAGAGCCCTGGCAGGGCTGCCGG - Intronic
1121322324 14:92999276-92999298 CACAGCACAGAGAGGGTGGCAGG + Intronic
1121612950 14:95293692-95293714 CACAAGCCAGAGAGGGCTGCGGG - Intronic
1121945275 14:98114812-98114834 CAGAGAACAGAGAGAGGTGCTGG - Intergenic
1122125688 14:99577326-99577348 CGAGGCTCAGAGAGGGCTGACGG + Intronic
1122183271 14:99971237-99971259 CAGAGCTCACAGAGGCCACCGGG - Intergenic
1122239450 14:100352575-100352597 CAGAGCCCAGCCTGGGCTGCAGG + Intronic
1122579137 14:102760849-102760871 CAGGGCTCAGTGCGGACTGCAGG - Intergenic
1122672003 14:103379646-103379668 CAGGGCTCACAGAGGGCAACAGG + Intergenic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1122809963 14:104282992-104283014 CAGAGCGCAGTGAGCACTGCTGG + Intergenic
1123142376 14:106093960-106093982 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123149697 14:106169163-106169185 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123150325 14:106175260-106175282 CAGATCTCAGAGGGACCTGCTGG - Intergenic
1123160684 14:106275628-106275650 CAGAGCTCAGGCAGCGATGCTGG + Intergenic
1123163929 14:106307796-106307818 CTGAGCACATAGAGGGCAGCAGG + Intergenic
1123480123 15:20623282-20623304 CAGGGCACAGGCAGGGCTGCTGG + Intergenic
1123637884 15:22377082-22377104 CAGGGCACAGGCAGGGCTGCTGG - Intergenic
1124103164 15:26713894-26713916 CAGGGATCAGAGACGGCTGGTGG + Intronic
1124607848 15:31184572-31184594 CACATCTCAGACAGGGCGGCGGG - Intergenic
1124619816 15:31267270-31267292 CAGATCTGAGACTGGGCTGCGGG - Intergenic
1124982946 15:34581926-34581948 TAGAGCCCACCGAGGGCTGCCGG + Intronic
1125513787 15:40306938-40306960 CACAGCAGAGAGAGGGCTGCAGG + Intronic
1125897658 15:43316103-43316125 AAGAGATCAGAGAGGGCTTTGGG - Intergenic
1126165199 15:45649058-45649080 CAGAGTTCAAACAGAGCTGCTGG - Intronic
1126249474 15:46551012-46551034 CAAAGCTCAAAGAGGGATGGGGG - Intergenic
1126417587 15:48433906-48433928 CAGATCACCTAGAGGGCTGCTGG + Intronic
1126940349 15:53759594-53759616 CAGAGCGCAGGTCGGGCTGCCGG - Intronic
1126996448 15:54450385-54450407 CACAGCTCAAGGAGGCCTGCCGG - Intronic
1127644659 15:60946951-60946973 CACTTCTCAGAGAGGGCGGCGGG - Intronic
1128064113 15:64753895-64753917 CAAAGGGCAGAGAGGCCTGCTGG - Intronic
1128638318 15:69317389-69317411 TAGGGGTCAGAGAAGGCTGCAGG - Intronic
1128690528 15:69721379-69721401 AAGAGGTGAGAGAGTGCTGCAGG + Intergenic
1128813031 15:70585814-70585836 CAGAGTTCAGGGGAGGCTGCGGG - Intergenic
1130356287 15:83133754-83133776 CATAGCTAATAAAGGGCTGCAGG - Exonic
1131248976 15:90818731-90818753 CAGGGCTCAGAGAAGCCAGCTGG + Intergenic
1131357769 15:91760691-91760713 AACAGCTCAGAGAGGACTGATGG - Intergenic
1132159533 15:99525854-99525876 CAGAACCCAAGGAGGGCTGCTGG + Intergenic
1132298768 15:100763735-100763757 AAGAGCCCAGTGAGGCCTGCAGG - Intergenic
1132304668 15:100802524-100802546 CAGGGCTCTGACAGGGCTCCAGG + Intergenic
1132348038 15:101120534-101120556 CAGAGCTCACAGAGGAGTGTGGG - Intergenic
1132478410 16:153806-153828 CGGTGCTCGGAGAGGGCCGCAGG + Intronic
1132480495 16:164396-164418 CGGTGCTCGGAGAGGGCCGCAGG + Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132688485 16:1172049-1172071 CAGAGTTCAGTGAAGGCTGCTGG - Intronic
1132714599 16:1284458-1284480 CAGAGCTCAGAAGCGGGTGCTGG - Intergenic
1132726295 16:1339719-1339741 CAGCACACAGAGACGGCTGCAGG + Intronic
1133862620 16:9610422-9610444 CAGAGCTCAGAGAGGCAGGAAGG + Intergenic
1134404949 16:13948485-13948507 CAGAGTTCAGAGAGGAATCCTGG - Exonic
1135464336 16:22672329-22672351 CAGAGTGCAGAGAGAGCTGGTGG - Intergenic
1135635376 16:24071234-24071256 CAGAGTTCTGAGAGGTCTGAAGG - Intronic
1135822025 16:25692867-25692889 CACGGCTCAGAGCGCGCTGCCGG + Exonic
1136035249 16:27534316-27534338 GGGAGCTCAGGGAGGGGTGCAGG + Intronic
1136679725 16:31951527-31951549 CAGATCTCAGAGGGACCTGCTGG + Intergenic
1137271272 16:46903880-46903902 GAGATCTCGGAGAGAGCTGCAGG + Intronic
1137472444 16:48774072-48774094 CACAGCTCAAGGAGGCCTGCCGG - Intergenic
1138032663 16:53572673-53572695 CAGAGGTCAGAGAGACCTGGGGG - Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1139357775 16:66377492-66377514 CTGACCTCAGGGAGGGCTGAGGG - Intronic
1139513860 16:67442147-67442169 CAGAGCACAGTGAGGGTTGGTGG - Intronic
1139547943 16:67658424-67658446 GCGAGCTCAGACAGGACTGCAGG + Intronic
1139614844 16:68082708-68082730 CAGGGCTCTCAGAGGGCTGAAGG + Intergenic
1139915369 16:70424989-70425011 CAGGGCACAGAGATGGCAGCTGG + Intronic
1140317838 16:73916253-73916275 CATAGCTCAGCCAGGGCTGCAGG - Intergenic
1140548356 16:75834899-75834921 CAGAGCTCAGGGAGTAATGCTGG + Intergenic
1141255259 16:82396296-82396318 CAGAGTTCAGTGAGAGCTTCAGG + Intergenic
1141964605 16:87433348-87433370 CAGAGCCCAGAGAGGAAGGCGGG + Intronic
1142349721 16:89574635-89574657 CAGGGCGCAGCGAGGCCTGCAGG - Intergenic
1143097130 17:4484135-4484157 CAGGGCTGAGAGAGGATTGCAGG - Intronic
1143268480 17:5658366-5658388 TAAAGCTCAGAGAGGGCAGGTGG - Intergenic
1144088106 17:11828777-11828799 CAGAGTTTAGAAAGGGCTTCTGG - Intronic
1144203878 17:12965373-12965395 CAGAGCTCAAGGGAGGCTGCTGG - Intronic
1144321184 17:14121894-14121916 CTGAGCCCAGAGAGGGAAGCTGG + Intronic
1144389937 17:14784224-14784246 CAAAGTAGAGAGAGGGCTGCGGG + Intergenic
1144641971 17:16942511-16942533 CAGAGCTCAGAGAGGCCTAACGG + Intronic
1144779229 17:17799577-17799599 CAGGGGCCAGAGAAGGCTGCAGG - Intronic
1145279456 17:21457159-21457181 GAAAGCTCAGAGCAGGCTGCGGG + Intergenic
1146006849 17:29165987-29166009 CAGAGCTCAGCGAGCTCAGCAGG - Exonic
1146278893 17:31532317-31532339 CACACATCACAGAGGGCTGCTGG - Exonic
1146503510 17:33384683-33384705 CTGAGCACAGAGAGGACTGAAGG - Intronic
1146543417 17:33717713-33717735 CTCAGCTCAGAGAGGACTGTTGG - Intronic
1146741182 17:35284996-35285018 CAGAACTTAGAGAGGGTTGTGGG + Intergenic
1147877984 17:43635108-43635130 CAGAGCTCAGAGAGTGGGGGAGG + Intergenic
1148866075 17:50629368-50629390 CAGGCCACAGAGAGGGCTGCTGG - Intergenic
1149422215 17:56521734-56521756 CACAGCACAGGGAGAGCTGCCGG + Intergenic
1150237667 17:63606066-63606088 CAAAGCTGAGAGATGGCTGATGG + Intronic
1151277393 17:73045907-73045929 CTGAGCTGAGAGAGTGCTGATGG - Intronic
1151372827 17:73659691-73659713 CAGAGCTCACTGTGGGCTGTGGG + Intergenic
1151596128 17:75078908-75078930 CAGAGCTGAGCGAAGGCTCCAGG - Intergenic
1151730883 17:75910418-75910440 CAGAGCCCAGTGAGAGCTGGGGG + Intronic
1151937562 17:77272189-77272211 CAGAGCTCAGAGACAGAGGCAGG + Intergenic
1153956301 18:10099204-10099226 CAGAGCACAGAGAGGCATTCAGG - Intergenic
1154412677 18:14149833-14149855 GAGAGGACAGAGACGGCTGCGGG + Intergenic
1155980502 18:32174838-32174860 GAGGGCTTAGAGAGGGCAGCGGG + Intronic
1156307588 18:35892815-35892837 CAGAGGTCTAAGGGGGCTGCTGG - Intergenic
1156383525 18:36585525-36585547 CAGGCCTCAAAGAGGGCAGCAGG + Intronic
1156464916 18:37342652-37342674 CACAGCTAAGAGATGCCTGCAGG - Intronic
1157583346 18:48786143-48786165 AGGAGCTCAGAGAGCACTGCAGG + Intronic
1157748888 18:50160889-50160911 ATGAGCTCAGAATGGGCTGCTGG - Intronic
1158192281 18:54843995-54844017 CATAACTCTGAGATGGCTGCAGG + Intronic
1158438906 18:57455979-57456001 CAGAGCTCTGAGAGGGAACCGGG - Intronic
1160128792 18:76205397-76205419 CAGAGCTCAGGGAAAGCTGGAGG + Intergenic
1160277579 18:77451788-77451810 CACAGGTCAGAGAGGGCTTTGGG + Intergenic
1160340379 18:78084281-78084303 CTGAGGTGGGAGAGGGCTGCAGG + Intergenic
1160366163 18:78327748-78327770 CAGAACTCAGAGCAGCCTGCAGG + Intergenic
1160385870 18:78495852-78495874 CAGAGCTCAGAGAAGGACACAGG + Intergenic
1160596054 18:79975116-79975138 CCCAGGTCAGATAGGGCTGCAGG - Intronic
1160673048 19:375456-375478 CAGGGCCCAGTGAGGGGTGCTGG + Intronic
1160792054 19:927498-927520 CAGGGCTCGGAGCGGGCTGGTGG + Intronic
1160855549 19:1215568-1215590 CTGAGCTCTGCCAGGGCTGCAGG - Intronic
1160972074 19:1773986-1774008 CAGATCACGGAGAGGGCTGAAGG - Intronic
1161209650 19:3059704-3059726 CAAAGCTCAGAGAGGGCTTCCGG + Intronic
1161364008 19:3868256-3868278 CAGAGATCAGCGAGGGTTCCTGG - Intronic
1161584332 19:5096891-5096913 AATAGCTCAGAGAAGGCTGAGGG + Intronic
1161668385 19:5590511-5590533 CGGAGCTGAGAGAGGACTGAAGG + Intronic
1161846227 19:6713330-6713352 GAGGGCTCAGAGAGGGGAGCGGG + Intronic
1162155227 19:8673368-8673390 CAAAGCTCAGAGACAGCTGCAGG + Intergenic
1162462008 19:10818873-10818895 CCTAGCTCAGAGAGGGAAGCTGG - Intronic
1162792918 19:13072284-13072306 GGGAGCTCACAGAGGGCTGGGGG - Intronic
1163676174 19:18656391-18656413 CAAGGCTCAGAGAGGGTGGCGGG - Intronic
1164557724 19:29266475-29266497 CACAACCCAGAGAGGGATGCAGG - Intergenic
1165111177 19:33503199-33503221 CAGGGCCCAGGGACGGCTGCAGG + Intronic
1165903815 19:39181411-39181433 CAAAGCTCTGAGAAGGCTGGAGG + Intronic
1166033043 19:40147429-40147451 CAGAAGTCAGAGAAGGCTACTGG + Intergenic
1166562632 19:43743424-43743446 CAGATCTCAGAGTGGGCTGATGG - Intronic
1168464355 19:56589784-56589806 CAGAACTCAGAGAGGACTTCAGG + Intergenic
925060795 2:888587-888609 CACTGCTCAGTGAGGGCTGGGGG + Intergenic
925065190 2:924085-924107 CAGAGCTCAGAGAGGCCCTGAGG + Intergenic
925178032 2:1798516-1798538 CAGAGATGACACAGGGCTGCAGG - Intronic
925201361 2:1969733-1969755 CAGTGTCCAGAGAGGGCTGCAGG - Intronic
925314359 2:2909716-2909738 CAGAGCTCAGGGGGTGCTGGAGG + Intergenic
925351823 2:3206353-3206375 CAGAGCCCCCAGTGGGCTGCAGG + Intronic
925377344 2:3397369-3397391 CAGAGCTCACACAGGGCTGAAGG - Intronic
925377356 2:3397441-3397463 CAGAGCTCACACAGGGCTGTGGG - Intronic
925669650 2:6297442-6297464 CAGACCTCAGTGGGGGCAGCCGG - Intergenic
925938141 2:8787892-8787914 CACAGCTCAGAGAGGGGAGCTGG + Intronic
926037055 2:9643931-9643953 CTGAGTTCTGAGGGGGCTGCTGG + Intergenic
926085452 2:10016988-10017010 TAGAGCTCAGAGAGTGGTGATGG + Intergenic
926108311 2:10166281-10166303 CAGAGACCAGAGCCGGCTGCAGG + Intronic
926185367 2:10686413-10686435 CTGAGCTCAGAGAGGAGGGCAGG + Intronic
926259274 2:11242397-11242419 CAGAGCTCAGAAAGGGAAGGAGG + Intronic
926355142 2:12034656-12034678 CAGAGATGAGAGAGGGATGTTGG - Intergenic
927948924 2:27154481-27154503 CAGAGCTGAAATAGGGCTGGGGG + Exonic
927982216 2:27381054-27381076 GAGAGCCCAGAGCGAGCTGCTGG - Intergenic
928200756 2:29246330-29246352 CCCAGCTCTGAGAGGGCTGTTGG - Intronic
929579825 2:43074781-43074803 CAGAGCTCAGGGATGCCTGCTGG - Intergenic
930879011 2:56250906-56250928 GAGAGGTCAGAGAGGGGTACTGG - Intronic
932253814 2:70267061-70267083 CACTTCTCAGAGAGGGCGGCTGG + Intronic
932261359 2:70330431-70330453 CTGAGCTCACAGAGTGCTGGAGG - Intergenic
932547123 2:72724871-72724893 TAAAGCACAGAGAGGGCTGAGGG + Intronic
933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG + Intronic
934036240 2:88091035-88091057 CAGTGATCAGAGAGGCCTGCAGG + Exonic
937205810 2:120236527-120236549 CTGAGCTCAGGGAGGCCTTCAGG - Intergenic
937241408 2:120464851-120464873 GAGAGCTCAAAGAAGGCTGGTGG - Intergenic
937454618 2:122030675-122030697 CTGATCTTAGATAGGGCTGCTGG - Intergenic
937921964 2:127137289-127137311 CCGAGCCCACAGAGGGGTGCTGG + Intergenic
938161475 2:128988362-128988384 AAGAGGTCAGAGAGGGCTTGAGG + Intergenic
940211827 2:151262822-151262844 CAGAGGTCCAAGAGGGCTCCTGG - Intergenic
942571054 2:177314803-177314825 CAGAGCTCAGATATGTATGCAGG + Intronic
944172114 2:196791412-196791434 CAGAGCTCTGAGAGGTCTCATGG - Exonic
946352307 2:219163291-219163313 CAAAGCCCAGAGAAGGCTGTGGG + Intronic
946434265 2:219641553-219641575 CAGGGAGCAGGGAGGGCTGCAGG + Intronic
946842296 2:223830851-223830873 CAGAGCCCAGAGATGCCTGTAGG + Intronic
947858118 2:233338258-233338280 CAGAGCTCAGAGAAGGGGCCTGG + Intronic
948027213 2:234787620-234787642 CAGAGCTTACAGAGGGTTGCAGG - Intergenic
948269179 2:236661137-236661159 CAGAGCTCTGAGAGGGGGGTGGG + Intergenic
948288239 2:236803852-236803874 CAGAGGTCAGAGAGAGAGGCAGG + Intergenic
948293169 2:236842401-236842423 CAGAGCCCTGAGTGGGCTGTGGG + Intergenic
948465862 2:238151341-238151363 GAGACCTCAGAGAGGGGAGCCGG + Exonic
948671915 2:239574388-239574410 CAGAACTCAGGGAGGGATTCGGG - Intergenic
1169047356 20:2544524-2544546 AAGATTTCAGAGAGGTCTGCAGG + Intronic
1169235547 20:3927031-3927053 CAGAGCTCAGGGAGGCCAGGGGG + Intronic
1169947708 20:11007065-11007087 CAGAGCTCCAAGAGGACTGATGG - Intergenic
1170508549 20:17054199-17054221 CAGAGCTCCCAGAGGGGTGGGGG - Intergenic
1170759168 20:19234647-19234669 CTGACTTCAGAGAGAGCTGCAGG + Intronic
1171044604 20:21798141-21798163 GGGAGCCCAGGGAGGGCTGCAGG + Intergenic
1171113028 20:22501603-22501625 CAGAGCACCTTGAGGGCTGCTGG - Intergenic
1171346034 20:24467384-24467406 CAGAGCTAAGAGAGGTCTGTGGG - Intergenic
1172274603 20:33672864-33672886 AACAGCTCAGAGAGGGCAGCTGG - Intronic
1172854579 20:37992161-37992183 CAGAGCCCAGATAGGGATGCAGG - Intronic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173135253 20:40433542-40433564 CAGAGCTCAGCCTGGGCTGTGGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174031944 20:47635942-47635964 CAGGGCACTGAGAGAGCTGCTGG - Exonic
1174496152 20:50944547-50944569 CAGAGGTCAGAAAGGGAGGCAGG + Intronic
1174565888 20:51464181-51464203 CAGAACTACGGGAGGGCTGCAGG + Intronic
1175134939 20:56816057-56816079 AAGACCTCAGAGTGGGCTGCAGG - Intergenic
1175426736 20:58872118-58872140 CAGAGCTCAGAGGGTGGTGGTGG - Intronic
1175923561 20:62461325-62461347 CAGAGCGCAGGGAGGGCTGGTGG + Intergenic
1175986366 20:62765930-62765952 CGGGGCTCAGAGAGGGATGAAGG + Intergenic
1176256631 20:64156439-64156461 TGGAGCTCAGAGGGGCCTGCAGG - Intronic
1176263589 20:64196770-64196792 CAGAGAATAGAGAGGGTTGCAGG - Intronic
1176860329 21:14008422-14008444 GAGAGGACAGAGACGGCTGCGGG - Intergenic
1177877346 21:26649722-26649744 CAGACCTCACAAAGGGCTACAGG + Intergenic
1178371117 21:32028447-32028469 AAGAGCTAAGAGGGGTCTGCAGG - Intronic
1178817138 21:35941922-35941944 TGCAGCTTAGAGAGGGCTGCAGG - Intronic
1178822610 21:35989554-35989576 CAGAGCTGAGCCAGGGTTGCAGG + Intronic
1179540939 21:42082956-42082978 CAGACCTCAGCCAAGGCTGCAGG - Intronic
1179732756 21:43376596-43376618 CAGAGCTCAGAGGAGGCAGGCGG - Intergenic
1179903498 21:44406998-44407020 CAGAGGTCAGAGTGGGCCGAGGG + Intronic
1181033769 22:20160320-20160342 CTGAGGCCAGAGAGGGCTGAAGG - Intergenic
1181178229 22:21049725-21049747 GAGAGGGCAGAGGGGGCTGCAGG + Intronic
1181319120 22:21991160-21991182 CAGAAGTCAGAGAGGGCAGCTGG - Intergenic
1181323533 22:22026545-22026567 CAGTGCTCACACAGTGCTGCAGG + Intergenic
1181464168 22:23101935-23101957 CCAAGCTTAGAGAGGGATGCGGG - Intronic
1181780173 22:25186769-25186791 CATAGCGCAGAGTGGGCTGTGGG + Intronic
1183076963 22:35433405-35433427 CACAGCTCAGAGAGGGCATGTGG + Intergenic
1184059875 22:42075029-42075051 CAGGGCTCAGAGAGGCCCTCAGG - Intronic
1184720453 22:46309533-46309555 CAGAGCTGGGAACGGGCTGCAGG - Intronic
1185182311 22:49370369-49370391 CAGAGCAGAGACAGGGCTGCAGG + Intergenic
1185309416 22:50145907-50145929 CAGTGCTCAGGGAGGGAGGCAGG + Intronic
950637524 3:14325217-14325239 CAGAGCAGGGAGAGGGCTGGAGG - Intergenic
951443316 3:22747726-22747748 CAGGTCCCAGAGAGGGCTTCAGG - Intergenic
951725577 3:25754611-25754633 CAGAGCTCCAAGAGAGCTGGTGG + Intronic
952342287 3:32456525-32456547 CTCAGCTCAGAGCCGGCTGCTGG - Intronic
953439674 3:42906651-42906673 CAGAGCGCACAGAGTGCTGTCGG + Intronic
953822656 3:46221889-46221911 CAGAGCTAAGTGAGGGGTGGCGG - Intronic
954304941 3:49720647-49720669 CAGAGCTGTGAGTGGGCTGGTGG + Exonic
954431230 3:50471842-50471864 CAGGGCACAGAGATGGCTGGGGG + Intronic
954479862 3:50788779-50788801 CAGAGCGCAGGGAGGGAGGCAGG + Intronic
954743864 3:52775607-52775629 CAGAGATCAGTGAGGGCTCTGGG + Intergenic
954875757 3:53802223-53802245 CAGCACTCAGAGAGGCCAGCTGG - Intronic
955327201 3:58018294-58018316 CATAGCTCAAAGAGGGTAGCAGG - Intronic
955378964 3:58421684-58421706 CAGAGGGCAGAGAATGCTGCAGG - Intronic
956482581 3:69687993-69688015 CTGAGCACAGGGTGGGCTGCAGG - Intergenic
956922986 3:73950723-73950745 CAGCGGTCAGAGAGGGCTTCTGG + Intergenic
957617603 3:82551362-82551384 GAGAGTTCAGAGAGGACTGAAGG - Intergenic
958166609 3:89885040-89885062 CACAGCTCAAGGAGGCCTGCTGG - Intergenic
959632136 3:108518662-108518684 CAGAGGTCAGAGAGTGCTGTTGG - Intronic
959904360 3:111694123-111694145 GAGGGATCAGAGGGGGCTGCAGG - Intronic
959939254 3:112063294-112063316 CAGTGCTCACAGAGAGCTCCAGG + Intronic
960159491 3:114334436-114334458 CAGAGCACAGACAGGACAGCTGG + Intergenic
961045042 3:123702257-123702279 CAGAGCTCAGAAATGCCAGCAGG - Intronic
961564607 3:127754570-127754592 CAGAGAGGAGAGAGGGCTGGCGG + Intronic
961622721 3:128237598-128237620 CAGAGCTGGGAGAGGGGAGCAGG - Intronic
962067249 3:131994649-131994671 CAGACCTTAGAGATGGCTTCAGG - Intronic
963282710 3:143401276-143401298 CAGAACCCAGAGAGGGTAGCTGG - Intronic
963558173 3:146823801-146823823 GAGAGCTCAGCTAGAGCTGCTGG + Intergenic
964069048 3:152609992-152610014 CAGAGCTCTGAATGGGCTGAGGG - Intergenic
964744953 3:160003655-160003677 CAGAGCCCAGGGAGGGCTGGAGG - Intergenic
964748858 3:160036497-160036519 CAGAGCCCAGGGAGGGCTGGAGG + Intergenic
964749526 3:160041467-160041489 CATAGCTCACACAGGGCTGCTGG + Intergenic
966781930 3:183591515-183591537 AAGAGCTCAAAGATGGCTGGAGG - Intergenic
967187054 3:186953228-186953250 CAGAGCTTAGAAAGGCCTACAGG + Intronic
967539999 3:190656293-190656315 CAGAGCTCAGAGAGGGCTGCAGG + Exonic
967964828 3:194952905-194952927 CAAAGCTCACTGAGGTCTGCTGG - Intergenic
967968774 3:194984338-194984360 CAGAGCTCATGGACAGCTGCAGG - Intergenic
968604030 4:1523122-1523144 CAGGGCTCAGTGAGGACAGCTGG + Intergenic
968984308 4:3866848-3866870 CAGAACACAGAATGGGCTGCGGG + Intergenic
969317813 4:6392653-6392675 CAGAGCTCAGAGAGGTGGGCTGG + Intronic
969509252 4:7608276-7608298 CACTCCTCAGAGAAGGCTGCCGG + Intronic
970538585 4:17055211-17055233 CAGTGTTGAGAGAGGGCTGGGGG - Intergenic
971215742 4:24660875-24660897 CAGAACACCCAGAGGGCTGCTGG + Intergenic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
972092218 4:35301498-35301520 CGGAGGTCAGAGAGTGCTGACGG - Intergenic
972240528 4:37187214-37187236 CAGAGCTGAGAGAGAGCTGTGGG + Intergenic
973021492 4:45208688-45208710 CACATCTCAGACAGGGCGGCCGG - Intergenic
975108819 4:70600559-70600581 GTGAGCTCAGAGAGGGGTGATGG + Intronic
975783783 4:77866556-77866578 AAGAGGTCAGAGAGGTCAGCTGG - Intronic
978562357 4:110046539-110046561 CAGAGCTCACAGATGGCAGGGGG - Exonic
979010308 4:115358460-115358482 CAGAGCAAAGAGAGGGCCACAGG - Intergenic
979685763 4:123508840-123508862 CAGAGCACAGAGGGGGCACCCGG + Intergenic
981080607 4:140635868-140635890 CTGAGGTCAGAGTGGCCTGCTGG + Intronic
981342139 4:143634022-143634044 CAGAGCCCAAACAGGGCAGCTGG + Intronic
981713574 4:147732061-147732083 CAGAGCTCGGCGGGGGCTGCCGG + Exonic
983221846 4:165051346-165051368 CAGAGCACCCCGAGGGCTGCTGG - Intergenic
984783929 4:183551512-183551534 GAGAGCTCAGGGAGCGCAGCGGG + Intergenic
984908403 4:184649854-184649876 CAGAGCTCAAACTGGGCAGCAGG - Exonic
984932561 4:184860023-184860045 CAGAGATGAGAGAGAGCTGTGGG + Intergenic
985043079 4:185911902-185911924 AAGATCCCAGAGATGGCTGCAGG + Intronic
985657890 5:1141490-1141512 GAGAGCACAGAGAGGGAGGCAGG - Intergenic
985701778 5:1377956-1377978 CAGAGCGCTCAGAGGGCAGCGGG - Intergenic
985857488 5:2441624-2441646 CTGAGGTCAGGGAGGGCTGCTGG - Intergenic
985922098 5:2985465-2985487 CAAAGCTCAGAGATCGCTGTGGG - Intergenic
986020310 5:3795530-3795552 CAGAACTCAGAGCTGACTGCAGG + Intergenic
986180133 5:5385406-5385428 CAGAGCTCAGAGGGAACAGCTGG + Intergenic
986249909 5:6046040-6046062 CAGCGCTCAGAGTGCGCTCCGGG + Intergenic
987103844 5:14617491-14617513 CTGAGCCCAGAAAGGGCAGCTGG - Intergenic
988450334 5:31336018-31336040 CAGAACTCAGAGAGCTTTGCAGG + Intergenic
988621729 5:32830083-32830105 CAGAGCACAGTGAGGTCTGCAGG - Intergenic
989828383 5:45886728-45886750 CACAGCTCAGGGAGGCCTGCTGG - Intergenic
990807658 5:59684171-59684193 CAGTGCTCAGGGAGGGATGGAGG - Intronic
990913826 5:60881474-60881496 CACAGCTCAAGGAGGCCTGCCGG - Intronic
991145324 5:63296264-63296286 CAGAGATTAGAGAGGGCAGTGGG - Intergenic
992616219 5:78548382-78548404 CAGAAATGTGAGAGGGCTGCTGG - Intronic
992863644 5:80936971-80936993 CAGCGCTCAGAGCATGCTGCTGG + Intergenic
993647749 5:90480291-90480313 CAGAGCTCAGAGAGAGTCCCTGG - Intronic
997670631 5:135668944-135668966 CATAGCTCAGTGAGGGAGGCAGG + Intergenic
998162878 5:139823278-139823300 GAGAGCCCAGAGAGGGGTCCCGG - Intronic
998513643 5:142734189-142734211 CAGAGCTGAGAAACAGCTGCAGG - Intergenic
999237741 5:150109134-150109156 CAGATCTCAGAGTGGCCAGCAGG - Intronic
999344095 5:150799306-150799328 GAGAGCTCAGAGAGGTCTACTGG + Intergenic
999939698 5:156528673-156528695 AAGAGCTAAGAGAGGGCTAAAGG + Intronic
1001084067 5:168687522-168687544 CAGAGGGCAGAGAGCACTGCAGG + Intronic
1001237626 5:170043446-170043468 CAGAGGAGAGGGAGGGCTGCAGG - Intronic
1001691951 5:173639551-173639573 CAAAGCTCACAGAGGGCAACTGG + Intergenic
1002324139 5:178394420-178394442 GTGAGCTGAGAGAGGGCTGGTGG - Intronic
1002508855 5:179699337-179699359 CAGAGGTCAAAGAAGGCTGTCGG - Intronic
1003060320 6:2857728-2857750 CAGCCCTCAGAGAGGGGTGTGGG - Intergenic
1003119298 6:3306759-3306781 CAGAGGACAGAGAGCCCTGCTGG + Intronic
1004013380 6:11710671-11710693 CAGAACTGAGAGAAGGCAGCCGG + Intergenic
1004224148 6:13770822-13770844 CAGAGCTCACAGATGGTGGCTGG - Intergenic
1005920544 6:30397275-30397297 CAGAGCAGAGAGAGGCCTCCAGG + Intergenic
1006940250 6:37747363-37747385 GAGAGTTCAGAAAGGGATGCTGG + Intergenic
1007081206 6:39105858-39105880 CATTGCTCTGAGAAGGCTGCTGG + Intronic
1007182742 6:39942144-39942166 AAGATCTCAGCAAGGGCTGCAGG - Intergenic
1007285001 6:40741258-40741280 CAGAGTTCAGAGAAGGCTGGAGG - Intergenic
1007359555 6:41345341-41345363 CACAGATCAGAGAGAGCTGGTGG - Intronic
1007488132 6:42196655-42196677 CAGAGCTCAGTGACGTCTGGAGG - Intergenic
1007685520 6:43665233-43665255 CAGAGGGCAGATAGGGCTGATGG - Intronic
1007908817 6:45492050-45492072 CAGAGTTCAGGGAGGGCCGTGGG - Exonic
1008559526 6:52710130-52710152 CAGAGCACCCTGAGGGCTGCTGG - Intergenic
1009984940 6:70771370-70771392 CACAGCTCAAGGAGGCCTGCCGG - Intronic
1010865202 6:80967847-80967869 GAGACCTCTGAGGGGGCTGCTGG + Intergenic
1011109588 6:83822180-83822202 CAGAGCTCAGAGTGGGCCTATGG + Intergenic
1011113104 6:83859944-83859966 GACAGCTTAGAGAGGGGTGCAGG - Intronic
1017744780 6:157436640-157436662 GAGCCCTCAGAGAGGTCTGCGGG + Intronic
1018378182 6:163232908-163232930 CAGAGTTGGGAGAGGGCTGAGGG - Intronic
1018414563 6:163590169-163590191 CAGAGCAGAGGGAGGGCAGCTGG - Intergenic
1018483271 6:164213552-164213574 AAGAGCTCAAAGAAGCCTGCTGG - Intergenic
1018793485 6:167168593-167168615 CGCAGCACAGAGAGGGATGCGGG + Intronic
1018823230 6:167389785-167389807 CGCAGCACAGAGAGGGATGCGGG - Intergenic
1018928194 6:168221825-168221847 CCCAGGTCAAAGAGGGCTGCTGG + Intergenic
1019144167 6:169966279-169966301 CAGAGCTCAGAGAAAGGTGGAGG - Intergenic
1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG + Intergenic
1022423508 7:30246218-30246240 CAAAGTTCAGAGGGGGCTGAGGG + Intergenic
1023038666 7:36153852-36153874 CAGAGTTGAGAGAGGCCTGGAGG + Intronic
1023084665 7:36558594-36558616 CACAGCTCAAGGAGGCCTGCTGG - Intronic
1023473286 7:40548983-40549005 AAGAGCTCAGTGAGGGCCTCCGG - Intronic
1023635505 7:42205505-42205527 CAAAGAACAGAGAGGGCAGCTGG + Intronic
1024202405 7:47120572-47120594 CAGAGGTCAGAGACACCTGCAGG - Intergenic
1024844663 7:53628533-53628555 CCTAGCCCAGAGAGGGCTACAGG + Intergenic
1024865097 7:53896319-53896341 GATAGCTCAGAGAAAGCTGCTGG - Intergenic
1025014470 7:55427848-55427870 GAGAGCACAGGGAGGGCTGAGGG + Intronic
1025034777 7:55587326-55587348 CACAGATGAGAGAGGGCTGGGGG - Intergenic
1025812820 7:64885965-64885987 CTGAGCTCAGAAAAGACTGCAGG + Intronic
1027235580 7:76295710-76295732 GACAGTTCAGAGAGGGCTGTGGG - Intergenic
1027428831 7:78088958-78088980 CAGAGGTCAGAGAGGACAGAAGG + Intronic
1028583691 7:92432650-92432672 TAGAGCCAAGAGAGGGCTGCAGG - Intergenic
1030095241 7:105892751-105892773 CATTGCTCAGGGAGGGCTGTGGG + Intronic
1030117040 7:106070020-106070042 CAATGGCCAGAGAGGGCTGCGGG + Intergenic
1031712777 7:125069890-125069912 GAGAGCTCAAGGAGGGCAGCAGG - Intergenic
1034855446 7:154541864-154541886 CACAGCTCAGTGATGGCTGAGGG + Intronic
1035120419 7:156562033-156562055 CAGGGCTCAGAGAAAGCAGCTGG + Intergenic
1035206255 7:157295642-157295664 CAGAGCTCTCTGAGGGCTCCGGG - Intergenic
1035272271 7:157727500-157727522 CAGAGGGTAGAGTGGGCTGCCGG + Intronic
1035272366 7:157728008-157728030 CAGAGCCCACAGACGTCTGCAGG - Intronic
1035457259 7:159016643-159016665 CAGACCTCAGAGTGGGCGTCCGG + Intergenic
1035544976 8:473371-473393 CTGAGTTTAGAGAGGACTGCTGG - Intergenic
1036114028 8:5938847-5938869 CTGAGTTCAGAGATGTCTGCAGG - Intergenic
1038176294 8:25184571-25184593 CAGAGCGCAGAGAGCGGCGCGGG + Intergenic
1039780402 8:40779500-40779522 GAGAGCTGAGAGGGGACTGCCGG + Intronic
1039892047 8:41692437-41692459 CACATCTCAGAGGAGGCTGCAGG - Intronic
1040386867 8:46920021-46920043 CAGAGCCCAGAGGCAGCTGCAGG - Intergenic
1040838862 8:51762448-51762470 CAGACTTCAGAGAGAGCAGCAGG - Intronic
1041044995 8:53880420-53880442 CAGAGCTCAGAGAGGCGCCCCGG + Intronic
1042521030 8:69711207-69711229 TTGAGCTCAGAGAGGGCTAGCGG - Intronic
1045354670 8:101374983-101375005 CAGGGCCCAGGGAGGGCTCCAGG + Intergenic
1047520323 8:125591058-125591080 CAGAGCTCTGAGGGGGAAGCTGG + Intergenic
1047523280 8:125612090-125612112 CAGAACTCAGAGCTTGCTGCAGG + Intergenic
1047771419 8:128033084-128033106 CAAAGCTCAGAGAAGCCTGAGGG - Intergenic
1048031804 8:130640198-130640220 CAGAGCTCAGGTGGGGCTGGTGG + Intergenic
1048603352 8:135942607-135942629 GAGAGCTCACAGCAGGCTGCTGG - Intergenic
1049059108 8:140262327-140262349 AAGAACTCAGGGAGGGCTGAGGG - Intronic
1049182197 8:141228737-141228759 CTGAGCTTAGCCAGGGCTGCAGG - Intronic
1049710701 8:144062045-144062067 CAGAGCACCCCGAGGGCTGCTGG - Intronic
1050381184 9:5032275-5032297 CACAGCTCAAGGAGGCCTGCCGG + Intronic
1052513466 9:29450904-29450926 CACAGCTCAAGGAGGCCTGCTGG + Intergenic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1053273111 9:36763418-36763440 CAGATCTCAGGGAGGGCCTCGGG - Intergenic
1053344942 9:37371347-37371369 CAGGGCTCAGACAGGGCTCAGGG + Intergenic
1053411867 9:37921003-37921025 GAGAGCTGGGAGAGGTCTGCTGG - Intronic
1054891082 9:70252589-70252611 CAGAGCTCTGGGAGGACTTCGGG - Intergenic
1054959122 9:70947630-70947652 CAGAGCTCAGAGAAGGTGGGGGG + Intronic
1056641992 9:88379276-88379298 AAGAACTCAGAGAGGGTTGAGGG - Intergenic
1058317537 9:103586951-103586973 CAGAGCCCAGAGTGGCCAGCTGG + Intergenic
1059344118 9:113616698-113616720 CAGAGCTCAGATCTGGCTGGAGG - Intergenic
1059684905 9:116625687-116625709 TAGATCACAGAGAGGGGTGCAGG - Intronic
1060024856 9:120162309-120162331 CTGAGGTCAAAGAGGGCAGCAGG - Intergenic
1060281541 9:122218896-122218918 CAGCGCTGAGAGAGCGGTGCAGG - Intronic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1060952410 9:127612520-127612542 CAGGCCTCCGAGCGGGCTGCCGG + Intronic
1060995885 9:127874758-127874780 CTGAGGGCAGAGGGGGCTGCTGG + Intronic
1061117992 9:128626724-128626746 CAGGGCCCAGAGAGGGCTCTGGG - Intronic
1061130203 9:128704035-128704057 CAGACCTCAGCGGGGCCTGCTGG - Intronic
1061750937 9:132776587-132776609 CAGAGCTCTGAGAGTGCTGCGGG + Intronic
1061896718 9:133652145-133652167 CAGAGGTCAGGGAGGCCTGAGGG + Intronic
1062337034 9:136075911-136075933 CTGAGCACATGGAGGGCTGCGGG - Intronic
1062337852 9:136080256-136080278 GAGAGCACAGAGATGGGTGCGGG - Intronic
1062631430 9:137464821-137464843 GAGAGCTCGGGGCGGGCTGCTGG + Intronic
1185502432 X:608290-608312 CTGAGCTCAGAGAGCACTGAAGG + Intergenic
1186202833 X:7171348-7171370 GAGAGCTGAGAGAGGGCAGGTGG - Intergenic
1186998262 X:15147585-15147607 TAGAGCTCAGAGAGTGATGGAGG + Intergenic
1187271926 X:17787789-17787811 CAGAGATCAGAGTGGGCCGACGG + Intergenic
1188007589 X:25026761-25026783 CAGAGCTAAAAGAGGGCAGGTGG + Intergenic
1189309435 X:40009337-40009359 GAGAACTCAGAGAGGGCACCGGG + Intergenic
1189316476 X:40060572-40060594 CAGAGGTAAGGGAGGGCTCCAGG - Intronic
1189373689 X:40449618-40449640 CAGGGCTCAGAGAGTGCTGGAGG + Intergenic
1189787570 X:44573074-44573096 CAGAGCTGCCTGAGGGCTGCTGG + Intergenic
1190515189 X:51216513-51216535 CAGAGCTTAGGGAGGGCAGGGGG - Intergenic
1190711254 X:53072289-53072311 CAGAGATAAGAGAGGGTAGCTGG - Intronic
1191187032 X:57624087-57624109 CACAGCTCAAGGAGGCCTGCCGG + Intergenic
1192139523 X:68635775-68635797 CACAGCTGGGAGAGTGCTGCTGG + Intergenic
1192140405 X:68642665-68642687 CAGAGCTCAGAGTTGGATCCAGG - Intergenic
1192204808 X:69088756-69088778 CAGGGCTCGGGGAGGGCTGCGGG + Intergenic
1192239486 X:69318073-69318095 CTGAGGACAAAGAGGGCTGCTGG + Intergenic
1192563403 X:72142687-72142709 CAGAGCTAAGAGAGAGCAGATGG - Intergenic
1195060724 X:101191549-101191571 CAGAGATAAAAGCGGGCTGCCGG - Intergenic
1195235864 X:102897739-102897761 CTGAGCTCAGAGACAGCAGCAGG - Intergenic
1197072610 X:122317998-122318020 CAGAGATCACAGAAGGCTGGTGG - Intergenic
1197119312 X:122871315-122871337 GAGGGCTCAGAGAAGGCTTCTGG + Intergenic
1197305273 X:124833986-124834008 CTGAGCTCTGTGAGGTCTGCAGG + Intronic
1198526490 X:137506687-137506709 CAACGTTTAGAGAGGGCTGCAGG - Intergenic
1199785811 X:151103839-151103861 CAGACCTCAGAGGGGGGTGCTGG + Intergenic
1200774640 Y:7159601-7159623 CACAGCTCAAGGAGGCCTGCAGG - Intergenic
1201734870 Y:17248413-17248435 CAGAGATGAGCGAGGGATGCTGG + Intergenic