ID: 967540433

View in Genome Browser
Species Human (GRCh38)
Location 3:190661004-190661026
Sequence AGAGCCTACAAGGGTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967540433_967540441 30 Left 967540433 3:190661004-190661026 CCTCTTTTACCCTTGTAGGCTCT No data
Right 967540441 3:190661057-190661079 CCTCTTAACAAGGTGTTTGCAGG No data
967540433_967540439 20 Left 967540433 3:190661004-190661026 CCTCTTTTACCCTTGTAGGCTCT No data
Right 967540439 3:190661047-190661069 TACAAATCATCCTCTTAACAAGG No data
967540433_967540436 -5 Left 967540433 3:190661004-190661026 CCTCTTTTACCCTTGTAGGCTCT No data
Right 967540436 3:190661022-190661044 GCTCTGATTTTCTCCAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967540433 Original CRISPR AGAGCCTACAAGGGTAAAAG AGG (reversed) Intergenic
No off target data available for this crispr