ID: 967542075

View in Genome Browser
Species Human (GRCh38)
Location 3:190679699-190679721
Sequence ATTCCAAGTTTCAAGGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967542075_967542078 13 Left 967542075 3:190679699-190679721 CCTTCAACCTTGAAACTTGGAAT No data
Right 967542078 3:190679735-190679757 TTTTCTTTTGCAGCCATATCAGG No data
967542075_967542079 17 Left 967542075 3:190679699-190679721 CCTTCAACCTTGAAACTTGGAAT No data
Right 967542079 3:190679739-190679761 CTTTTGCAGCCATATCAGGCAGG No data
967542075_967542081 24 Left 967542075 3:190679699-190679721 CCTTCAACCTTGAAACTTGGAAT No data
Right 967542081 3:190679746-190679768 AGCCATATCAGGCAGGCCTAGGG No data
967542075_967542080 23 Left 967542075 3:190679699-190679721 CCTTCAACCTTGAAACTTGGAAT No data
Right 967542080 3:190679745-190679767 CAGCCATATCAGGCAGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967542075 Original CRISPR ATTCCAAGTTTCAAGGTTGA AGG (reversed) Intergenic
No off target data available for this crispr