ID: 967542076

View in Genome Browser
Species Human (GRCh38)
Location 3:190679706-190679728
Sequence ACTTTTTATTCCAAGTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967542076_967542079 10 Left 967542076 3:190679706-190679728 CCTTGAAACTTGGAATAAAAAGT No data
Right 967542079 3:190679739-190679761 CTTTTGCAGCCATATCAGGCAGG No data
967542076_967542080 16 Left 967542076 3:190679706-190679728 CCTTGAAACTTGGAATAAAAAGT No data
Right 967542080 3:190679745-190679767 CAGCCATATCAGGCAGGCCTAGG No data
967542076_967542078 6 Left 967542076 3:190679706-190679728 CCTTGAAACTTGGAATAAAAAGT No data
Right 967542078 3:190679735-190679757 TTTTCTTTTGCAGCCATATCAGG No data
967542076_967542081 17 Left 967542076 3:190679706-190679728 CCTTGAAACTTGGAATAAAAAGT No data
Right 967542081 3:190679746-190679768 AGCCATATCAGGCAGGCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967542076 Original CRISPR ACTTTTTATTCCAAGTTTCA AGG (reversed) Intergenic
No off target data available for this crispr