ID: 967542080

View in Genome Browser
Species Human (GRCh38)
Location 3:190679745-190679767
Sequence CAGCCATATCAGGCAGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967542076_967542080 16 Left 967542076 3:190679706-190679728 CCTTGAAACTTGGAATAAAAAGT No data
Right 967542080 3:190679745-190679767 CAGCCATATCAGGCAGGCCTAGG No data
967542075_967542080 23 Left 967542075 3:190679699-190679721 CCTTCAACCTTGAAACTTGGAAT No data
Right 967542080 3:190679745-190679767 CAGCCATATCAGGCAGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967542080 Original CRISPR CAGCCATATCAGGCAGGCCT AGG Intergenic
No off target data available for this crispr