ID: 967546553

View in Genome Browser
Species Human (GRCh38)
Location 3:190736896-190736918
Sequence CTGCAAATTCAGATGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967546553_967546556 1 Left 967546553 3:190736896-190736918 CCATGATCCATCTGAATTTGCAG No data
Right 967546556 3:190736920-190736942 CGCTACATAGCTGAACTGAATGG No data
967546553_967546557 2 Left 967546553 3:190736896-190736918 CCATGATCCATCTGAATTTGCAG No data
Right 967546557 3:190736921-190736943 GCTACATAGCTGAACTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967546553 Original CRISPR CTGCAAATTCAGATGGATCA TGG (reversed) Intergenic
No off target data available for this crispr