ID: 967547955

View in Genome Browser
Species Human (GRCh38)
Location 3:190753974-190753996
Sequence ACTGATAAGCAATTATAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967547955_967547957 5 Left 967547955 3:190753974-190753996 CCTTGCTATAATTGCTTATCAGT No data
Right 967547957 3:190754002-190754024 GAGATTTTTTTCAATTCTTTTGG No data
967547955_967547958 19 Left 967547955 3:190753974-190753996 CCTTGCTATAATTGCTTATCAGT No data
Right 967547958 3:190754016-190754038 TTCTTTTGGACTTTTTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967547955 Original CRISPR ACTGATAAGCAATTATAGCA AGG (reversed) Intergenic
No off target data available for this crispr