ID: 967551040

View in Genome Browser
Species Human (GRCh38)
Location 3:190796362-190796384
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967551036_967551040 -3 Left 967551036 3:190796342-190796364 CCATATACTGAGACACCAGCTAG No data
Right 967551040 3:190796362-190796384 TAGGGAAGTCAAGCGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr