ID: 967553087

View in Genome Browser
Species Human (GRCh38)
Location 3:190822901-190822923
Sequence GCTCACCTACTTGCTAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967553087_967553094 25 Left 967553087 3:190822901-190822923 CCTGGGTTAGCAAGTAGGTGAGC No data
Right 967553094 3:190822949-190822971 ATGTGTTGATTTGGTCTGCTAGG No data
967553087_967553089 -2 Left 967553087 3:190822901-190822923 CCTGGGTTAGCAAGTAGGTGAGC No data
Right 967553089 3:190822922-190822944 GCCTGAAGCCTGGTTACACTTGG No data
967553087_967553093 16 Left 967553087 3:190822901-190822923 CCTGGGTTAGCAAGTAGGTGAGC No data
Right 967553093 3:190822940-190822962 CTTGGGTGAATGTGTTGATTTGG No data
967553087_967553091 -1 Left 967553087 3:190822901-190822923 CCTGGGTTAGCAAGTAGGTGAGC No data
Right 967553091 3:190822923-190822945 CCTGAAGCCTGGTTACACTTGGG No data
967553087_967553096 30 Left 967553087 3:190822901-190822923 CCTGGGTTAGCAAGTAGGTGAGC No data
Right 967553096 3:190822954-190822976 TTGATTTGGTCTGCTAGGGTAGG No data
967553087_967553095 26 Left 967553087 3:190822901-190822923 CCTGGGTTAGCAAGTAGGTGAGC No data
Right 967553095 3:190822950-190822972 TGTGTTGATTTGGTCTGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967553087 Original CRISPR GCTCACCTACTTGCTAACCC AGG (reversed) Intergenic
No off target data available for this crispr