ID: 967553092

View in Genome Browser
Species Human (GRCh38)
Location 3:190822930-190822952
Sequence ACATTCACCCAAGTGTAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967553092_967553094 -4 Left 967553092 3:190822930-190822952 CCTGGTTACACTTGGGTGAATGT No data
Right 967553094 3:190822949-190822971 ATGTGTTGATTTGGTCTGCTAGG No data
967553092_967553095 -3 Left 967553092 3:190822930-190822952 CCTGGTTACACTTGGGTGAATGT No data
Right 967553095 3:190822950-190822972 TGTGTTGATTTGGTCTGCTAGGG No data
967553092_967553096 1 Left 967553092 3:190822930-190822952 CCTGGTTACACTTGGGTGAATGT No data
Right 967553096 3:190822954-190822976 TTGATTTGGTCTGCTAGGGTAGG No data
967553092_967553097 6 Left 967553092 3:190822930-190822952 CCTGGTTACACTTGGGTGAATGT No data
Right 967553097 3:190822959-190822981 TTGGTCTGCTAGGGTAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967553092 Original CRISPR ACATTCACCCAAGTGTAACC AGG (reversed) Intergenic
No off target data available for this crispr