ID: 967553094

View in Genome Browser
Species Human (GRCh38)
Location 3:190822949-190822971
Sequence ATGTGTTGATTTGGTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967553092_967553094 -4 Left 967553092 3:190822930-190822952 CCTGGTTACACTTGGGTGAATGT No data
Right 967553094 3:190822949-190822971 ATGTGTTGATTTGGTCTGCTAGG No data
967553087_967553094 25 Left 967553087 3:190822901-190822923 CCTGGGTTAGCAAGTAGGTGAGC No data
Right 967553094 3:190822949-190822971 ATGTGTTGATTTGGTCTGCTAGG No data
967553090_967553094 3 Left 967553090 3:190822923-190822945 CCTGAAGCCTGGTTACACTTGGG No data
Right 967553094 3:190822949-190822971 ATGTGTTGATTTGGTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967553094 Original CRISPR ATGTGTTGATTTGGTCTGCT AGG Intergenic
No off target data available for this crispr