ID: 967553124

View in Genome Browser
Species Human (GRCh38)
Location 3:190823129-190823151
Sequence TGGCAGGTCTAGCATTGTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967553114_967553124 26 Left 967553114 3:190823080-190823102 CCCAAGGTTGCTAAGTTGAGTTG No data
Right 967553124 3:190823129-190823151 TGGCAGGTCTAGCATTGTAGCGG No data
967553123_967553124 -10 Left 967553123 3:190823116-190823138 CCTGGAAATGCTATGGCAGGTCT No data
Right 967553124 3:190823129-190823151 TGGCAGGTCTAGCATTGTAGCGG No data
967553115_967553124 25 Left 967553115 3:190823081-190823103 CCAAGGTTGCTAAGTTGAGTTGG No data
Right 967553124 3:190823129-190823151 TGGCAGGTCTAGCATTGTAGCGG No data
967553113_967553124 27 Left 967553113 3:190823079-190823101 CCCCAAGGTTGCTAAGTTGAGTT No data
Right 967553124 3:190823129-190823151 TGGCAGGTCTAGCATTGTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967553124 Original CRISPR TGGCAGGTCTAGCATTGTAG CGG Intergenic
No off target data available for this crispr