ID: 967554476

View in Genome Browser
Species Human (GRCh38)
Location 3:190838395-190838417
Sequence TTATTACCTCGGCCAGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967554471_967554476 4 Left 967554471 3:190838368-190838390 CCATACTGCCTTTTCTGACTTCC No data
Right 967554476 3:190838395-190838417 TTATTACCTCGGCCAGTGCAGGG No data
967554472_967554476 -4 Left 967554472 3:190838376-190838398 CCTTTTCTGACTTCCTGCTTTAT No data
Right 967554476 3:190838395-190838417 TTATTACCTCGGCCAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967554476 Original CRISPR TTATTACCTCGGCCAGTGCA GGG Intergenic
No off target data available for this crispr