ID: 967554871

View in Genome Browser
Species Human (GRCh38)
Location 3:190845033-190845055
Sequence GTGTTGAATTTTGAGTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967554871_967554873 23 Left 967554871 3:190845033-190845055 CCACTCAACTCAAAATTCAACAC No data
Right 967554873 3:190845079-190845101 CAGAGAGCTTAGAAAAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967554871 Original CRISPR GTGTTGAATTTTGAGTTGAG TGG (reversed) Intergenic
No off target data available for this crispr