ID: 967557418

View in Genome Browser
Species Human (GRCh38)
Location 3:190876058-190876080
Sequence CCACTGTGCTTGGCTGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 2, 2: 9, 3: 62, 4: 458}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967557415_967557418 4 Left 967557415 3:190876031-190876053 CCAAAGTGCTAGGATTACAGGCA 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
Right 967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG 0: 1
1: 2
2: 9
3: 62
4: 458
967557414_967557418 5 Left 967557414 3:190876030-190876052 CCCAAAGTGCTAGGATTACAGGC 0: 15701
1: 240057
2: 272945
3: 174764
4: 138480
Right 967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG 0: 1
1: 2
2: 9
3: 62
4: 458
967557412_967557418 8 Left 967557412 3:190876027-190876049 CCTCCCAAAGTGCTAGGATTACA 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
Right 967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG 0: 1
1: 2
2: 9
3: 62
4: 458
967557409_967557418 21 Left 967557409 3:190876014-190876036 CCACCTGCTGCGGCCTCCCAAAG 0: 29
1: 1206
2: 32895
3: 125136
4: 167372
Right 967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG 0: 1
1: 2
2: 9
3: 62
4: 458
967557410_967557418 18 Left 967557410 3:190876017-190876039 CCTGCTGCGGCCTCCCAAAGTGC 0: 56
1: 2955
2: 96725
3: 235081
4: 237397
Right 967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG 0: 1
1: 2
2: 9
3: 62
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967557418 Original CRISPR CCACTGTGCTTGGCTGACAC TGG Intronic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
900983896 1:6062023-6062045 CCACCGCGCTTGGCTGACACTGG - Intronic
901050049 1:6421423-6421445 CGACTTAGCTTGGCTGACTCAGG + Intronic
901471420 1:9459360-9459382 CCACTGTGCTTGGCCCAAAATGG - Intergenic
901541669 1:9921677-9921699 CCACTGCGCCCGGCTGAGACAGG + Intergenic
902208327 1:14886132-14886154 CCACTGTGTCTGGCCTACACAGG - Intronic
902807818 1:18871977-18871999 CCACTGTGCCATGGTGACACAGG - Exonic
902997524 1:20238416-20238438 CCACTGTGCCTGGCCCACCCTGG - Intergenic
903311320 1:22458876-22458898 CCACTGTGCCAGGCTGTCATTGG + Intronic
903745589 1:25584591-25584613 CCACTGGGCTTGGTTGAGAGGGG + Intergenic
903785991 1:25861725-25861747 CCACTGCGCCTGGCCGACAAAGG - Exonic
903928976 1:26851299-26851321 GGACTGTGCTTGGCTGCCCCAGG - Intronic
905216553 1:36412445-36412467 CAAATGTCCTTTGCTGACACGGG + Intergenic
905337973 1:37258334-37258356 CCACTGTGGCAGGCTGACCCTGG - Intergenic
905598873 1:39233319-39233341 CCACTGTGCCTGGCCAACCCAGG + Intronic
905792400 1:40797209-40797231 CCTCTGTGCTGGGCTCCCACTGG - Intronic
905815890 1:40950574-40950596 CCACTGTGCCTGGCTGAGGAAGG + Intergenic
906224197 1:44107390-44107412 CCACCGCGCCTGGCTGAGACTGG + Intergenic
906367950 1:45226675-45226697 CCATTGCACTTGGCTGAAACAGG + Intronic
906801018 1:48736994-48737016 CCACCATGCCTGGCTGTCACTGG - Intronic
907030562 1:51166886-51166908 CCACTGCGCCCGGCTGTCACTGG + Intergenic
907874841 1:58475447-58475469 CCACTGTGCCTGGCTGAATTAGG + Intronic
908020397 1:59892475-59892497 CCACTGTGCCTGGCCGACCTTGG - Intergenic
908526839 1:64996028-64996050 CCACTGCGCCTGGCTGACATTGG + Intergenic
911171538 1:94775484-94775506 CTGCTGTGATTGGCTGACATCGG - Intergenic
912719153 1:112005098-112005120 CCACTTTGCTTGGATGATAAGGG + Intergenic
912929074 1:113940090-113940112 CCACTGTGCCTGGCCCATACTGG + Intronic
914400056 1:147310663-147310685 CCACTGTGCCTGGCCAACAATGG - Intergenic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
915424469 1:155813142-155813164 CCACCGTGCCTGGCTGAGAATGG - Intronic
916139761 1:161685407-161685429 CCACTGTGCCTGGGTGATCCTGG - Intergenic
916505112 1:165421817-165421839 CCACTGTGCCTGGCTGGCTCTGG + Intronic
916767664 1:167877359-167877381 GCACTGTGCTTGGCATACATAGG - Intronic
916798100 1:168186632-168186654 CCACTGTGCCCGGATGACATAGG - Intronic
917203786 1:172546619-172546641 CCACTGTGCCTGGCCTATACAGG - Intronic
918116930 1:181505903-181505925 CCACTGTACTTGGCACACAGTGG - Intronic
918296008 1:183158066-183158088 CCACTGTGCCTGGCCGTCACTGG - Intergenic
918781195 1:188702522-188702544 CCAGTGTGCTTGGCTGGGATTGG - Intergenic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
920166221 1:204037955-204037977 CCATTGTGCTTGGCTCACCAGGG - Intergenic
920363084 1:205432719-205432741 CCACTGTGCCTGGCTGAGGTGGG - Intronic
922241299 1:223756975-223756997 CCACTGGACCTGGCTGACAGAGG + Intronic
922814790 1:228440811-228440833 CCACTGTGCCTGGCTGAAGTCGG + Intergenic
924477915 1:244397521-244397543 CCACTGGGATTGGGAGACACTGG + Intergenic
924535259 1:244930203-244930225 GCACTGTGAGTGGCTGAGACAGG + Intergenic
924535879 1:244935380-244935402 GCACTGTGAGTGGCTGAGACAGG - Intergenic
924733231 1:246731183-246731205 ACCCTGTGCTTGTCTGAGACAGG - Intronic
924809244 1:247386778-247386800 CCACTGTGCCCGGCTTAGACTGG + Intergenic
924865812 1:247978807-247978829 CCACAGTGCTTCTCTGACACAGG + Intronic
924868442 1:248012257-248012279 CCACAGTGCTTCTCTGACACAGG + Intronic
1062908458 10:1195771-1195793 CCACTGTGCTTTGCTGGCTCGGG - Intronic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1063680010 10:8177997-8178019 CCACTGTGCCTGGCTAATAAAGG + Intergenic
1064055461 10:12093468-12093490 CCACTGTGCCAGGCTGAAATTGG + Intronic
1064769164 10:18706177-18706199 CCACTGTGCCTGGCCTACCCTGG + Intergenic
1065090411 10:22227532-22227554 CCAGTGTGGGTGGCTGACACCGG - Intergenic
1067270875 10:44790324-44790346 GCACTGAGCTTGGCGGACACAGG + Intergenic
1067345937 10:45439354-45439376 CCACTGTGCTGCAGTGACACTGG + Intronic
1069479945 10:68772603-68772625 CCACTGTGCCTGGCTTAAAATGG - Intronic
1070003798 10:72402799-72402821 CCACTGTGGGAGGCTGAGACAGG + Intronic
1070983756 10:80670483-80670505 TCAGTGTGCTTTGCTGACTCGGG - Intergenic
1071984363 10:91035971-91035993 CCACTGTGCTGACCTGACAATGG - Intergenic
1072106880 10:92282961-92282983 CCACTGTGCCTGGCTGATTTAGG - Intronic
1072143914 10:92616122-92616144 CCACTGTGCCCGGCTGATATAGG + Intronic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1072520751 10:96227772-96227794 GCACTGTCCTTGGGGGACACAGG + Intronic
1072609205 10:97005255-97005277 CCACTAGGCTTGGATGACTCTGG - Intronic
1074052663 10:109894242-109894264 CCACTGTGCCTGGCTGAAAGGGG - Intronic
1074059466 10:109951669-109951691 CCACTGCACCTGGCTGTCACTGG - Intronic
1074873758 10:117597996-117598018 CCACTGTACCTGGCCCACACTGG + Intergenic
1075049885 10:119175680-119175702 CCACAGTGCCTGGCTGAGATGGG + Intronic
1075602166 10:123777708-123777730 CCAACGTGCGTGGCTGGCACTGG - Intronic
1075675775 10:124294896-124294918 CCACCCTGCTTGGCTGGCACAGG + Intergenic
1077604602 11:3600392-3600414 AAACTGTGCTGGGCTGACATCGG - Intergenic
1078269974 11:9786146-9786168 CCACTGCGCCTGGCAGACACTGG + Intronic
1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG + Intronic
1079402048 11:20113719-20113741 CCACTGTGCTGGGCTGGTCCTGG - Intronic
1080044779 11:27797524-27797546 CCACCGCGCTTGGCTGAAATAGG - Intergenic
1080689957 11:34548339-34548361 CCACTGTGTCTGGCTGAGCCAGG + Intergenic
1080933793 11:36840577-36840599 TCATTGTCCTTGTCTGACACAGG - Intergenic
1081740820 11:45438725-45438747 CCACTGCGCCTGGCTGAGTCTGG + Intergenic
1082030053 11:47597304-47597326 CCACTGCGCCTGGCTGAGATAGG + Intergenic
1082275696 11:50219084-50219106 CCACTGTGCCTGGCCCACAGAGG - Intergenic
1082814991 11:57501751-57501773 CCACTGTGGGAGGCTGAGACAGG + Intronic
1083014515 11:59439301-59439323 ACACTATCCTTGACTGACACGGG - Intergenic
1083946898 11:65928673-65928695 CCACTGTGCCCGGCCGACCCTGG + Intergenic
1084122287 11:67076723-67076745 CCACTGCGCCCGGCTGGCACAGG - Intergenic
1084845247 11:71893662-71893684 AACCTGTGCTGGGCTGACACCGG + Intronic
1085135360 11:74082400-74082422 CCACTGTGCCCGGCTGACTGTGG + Intronic
1085831262 11:79903358-79903380 CCACAGTGCTTGGCCCACACTGG + Intergenic
1085858431 11:80203288-80203310 CCACTGTGTCTGGCTGAAATTGG + Intergenic
1086094755 11:83039389-83039411 CCACTGCGCTTAGCTGAGAATGG - Intronic
1086927166 11:92652873-92652895 CCACTGTGCCTGTCTGAGAAGGG - Intronic
1087594066 11:100231865-100231887 CCACTGTGCCTGGCCTTCACAGG - Intronic
1089365091 11:117916566-117916588 CCACTGTGCTGGGCTCATAGTGG + Intronic
1089421860 11:118338098-118338120 CCACTGCACCTGGCTGAGACAGG - Intergenic
1089495375 11:118905919-118905941 CCACTGTGCCTGGCAAACATAGG - Intronic
1090038689 11:123271380-123271402 CCACTGCACCTGGCCGACACTGG - Intergenic
1090587381 11:128228689-128228711 CCACTGTGCCGGGCTGATTCAGG - Intergenic
1090656024 11:128846222-128846244 CCACTGACCTTTGCTGATACAGG + Intronic
1091115967 11:133013790-133013812 GCACTGTGCTTCTCTGACACTGG - Intronic
1091318952 11:134636218-134636240 CCGCTGTGCTCGGCTGACATTGG + Intergenic
1091425139 12:381279-381301 CCACCGTGCCCGGCTGAGACAGG + Intronic
1092351672 12:7761067-7761089 CCACTGTGCCCGGCTGAGAATGG - Intergenic
1095837288 12:46652662-46652684 ACCATGTGCTTGGCAGACACAGG + Intergenic
1096806152 12:54142367-54142389 CCACTGTGCCTGGCCGAGCCTGG - Intergenic
1097689097 12:62717124-62717146 CCACTGTGCTTGGCCTAAACTGG + Intronic
1099777258 12:87149945-87149967 ACACAGTTCTTGGCTGATACTGG + Intergenic
1099843442 12:87997105-87997127 CCACTGTGCTGGGTTGATATGGG + Intronic
1100203789 12:92326841-92326863 CCTCTGCCCTTGACTGACACTGG + Intergenic
1100858971 12:98784469-98784491 CCACAGTGGCTGGCTCACACAGG + Intronic
1100981624 12:100166820-100166842 CAACTGTGGATGGCTGACAATGG + Intergenic
1101054274 12:100896110-100896132 CCACTGTGGTGGGCTGATAATGG + Intronic
1101384142 12:104241324-104241346 CCACTGTGCCCGGCTGCCAATGG + Intronic
1102264660 12:111473024-111473046 CCACTTTGTGAGGCTGACACAGG + Intronic
1103587679 12:121968259-121968281 GCACTGTGCTAGGATGTCACAGG + Intronic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1104006927 12:124899575-124899597 CCACTGTGCCTGGTCTACACTGG + Intergenic
1104187233 12:126444436-126444458 CCGCTGTGCCTGGCTAACATGGG + Intergenic
1104739538 12:131163225-131163247 CCCCCGTGCCTGGGTGACACTGG - Intergenic
1106411661 13:29515152-29515174 CCACCTTGTGTGGCTGACACAGG + Intronic
1107917823 13:45170297-45170319 CCACTGTGCCCAGCTGAGACTGG + Intronic
1109312937 13:60716772-60716794 CCAGTGTGCTTTGGTGCCACTGG + Intergenic
1109927038 13:69157493-69157515 CCACTGGACTTGCTTGACACAGG - Intergenic
1111543218 13:89695900-89695922 CCAGTGTGCTTGGGTGCAACTGG - Intergenic
1112197876 13:97243118-97243140 CCACTGTCCGTGCCTGCCACTGG - Intronic
1113818358 13:113191967-113191989 CCACTGTGCTTGGCTCATCGAGG - Intronic
1114235782 14:20822596-20822618 CCACTGTACCTGGCTGGCATTGG - Intergenic
1115087483 14:29535016-29535038 CCACTGCGCCTGGCCGACCCTGG + Intergenic
1117513941 14:56481780-56481802 CCAAAATGCTTGGCTGGCACAGG + Intergenic
1118573472 14:67218411-67218433 CAAGTCTGCTTGGCTGACTCAGG + Intronic
1118851095 14:69584159-69584181 CCACTGTGCCTGTCTCACCCAGG - Intergenic
1119050041 14:71358147-71358169 CCACTGTGCCCGGCCAACACTGG + Intronic
1119056151 14:71421987-71422009 CCACTGTGCTGGGATTACAGTGG - Intronic
1119672295 14:76528939-76528961 CCACTGTGCCCGGCCGAAACAGG + Intergenic
1120253392 14:82088421-82088443 CCACTATGCCTGGCTGAGACTGG + Intergenic
1120788875 14:88561467-88561489 CCACTGTGCCTGGCTTTTACTGG + Intergenic
1121282421 14:92708921-92708943 TCACTGTGCTGTGCTGACAATGG + Intronic
1121497893 14:94409593-94409615 CCACTGTGCCTGGCCAACAGAGG + Intergenic
1121879661 14:97488695-97488717 CCTCTGTGCTGGGCAGTCACTGG - Intergenic
1122058872 14:99123379-99123401 TCACTGTGCTGAGCTCACACAGG + Intergenic
1122174777 14:99908821-99908843 CCATTGTTCGTGGCTGACTCTGG - Intronic
1122362233 14:101174321-101174343 GCACTGGGCTGGGGTGACACTGG - Intergenic
1122401899 14:101472325-101472347 CCACTGGGCTTGGCTCAGAATGG - Intergenic
1122801138 14:104230139-104230161 CCACTGAGCTTAGCAGACAGTGG - Intergenic
1123003567 14:105310241-105310263 CCACTGTGCCTGGCTCACTAGGG - Exonic
1123541361 15:21295107-21295129 AAACTGTGATTGGCTGACAAAGG + Intergenic
1125298422 15:38228337-38228359 CCACTGTGCCTGGCTTACTTGGG - Intergenic
1125487051 15:40118758-40118780 CCACTGAGCCTGGCCAACACTGG - Intergenic
1125768026 15:42147901-42147923 CCACTGTGCCTGGCTGAAAATGG - Intronic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126746816 15:51834541-51834563 CCACTGTGCCTGGCCGAGAAAGG - Intronic
1127631326 15:60829935-60829957 GCACTGTGCTTGGCATACAGTGG + Intronic
1127640452 15:60911220-60911242 CCACTGTGCCCGGCTGACTCTGG + Intronic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1128299463 15:66556590-66556612 CCACCGTGCCCGGCTGACAATGG + Intronic
1129037900 15:72662038-72662060 GCACTGTGGGTGGCTGACAACGG - Intronic
1129120301 15:73392354-73392376 CCACTGTGCCCGGCCCACACTGG - Intergenic
1129211989 15:74075189-74075211 GCACTGTGGGTGGCTGACAACGG + Intronic
1129398414 15:75265896-75265918 GCACTGTGGGTGGCTGACAACGG - Intronic
1129402022 15:75290171-75290193 GCACTGTGGGTGGCTGACAACGG - Intronic
1129510033 15:76114981-76115003 CCACTGTGCCTGGCCAACAAGGG - Intronic
1129546827 15:76404527-76404549 ACACTGTGCTTTGCTGTCACTGG - Exonic
1129570342 15:76676110-76676132 CCACTGTGCCCGGCTGAAACTGG + Intronic
1129729115 15:77919510-77919532 GCACTGTGGGTGGCTGACAACGG + Intergenic
1130259709 15:82345595-82345617 GCACTGTGGGTGGCTGACAATGG + Intronic
1130269010 15:82433841-82433863 GCACTGTGGGTGGCTGACAATGG - Intronic
1130281524 15:82523414-82523436 GCACTGTGGGTGGCTGACAATGG - Intergenic
1130320107 15:82834321-82834343 CCACCGTGCCTGGCTGATGCTGG + Exonic
1130480388 15:84354168-84354190 GCACTGTGGGTGGCTGACAATGG - Intergenic
1130484603 15:84391726-84391748 GCACTGTGGGTGGCTGACAACGG - Intergenic
1130491381 15:84433961-84433983 GCACTGTGGGTGGCTGACAATGG + Intergenic
1130502997 15:84513001-84513023 GCACTGTGGGTGGCTGACAATGG + Intergenic
1130595190 15:85244231-85244253 GCACTGTGGGTGGCTGACAATGG - Intergenic
1131036485 15:89225895-89225917 CCACTGTGCTGGGCACAGACAGG - Intergenic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1131254111 15:90850425-90850447 CCACTGCGCCTGGCTGAGAAAGG + Intergenic
1131489348 15:92849152-92849174 CAACTGTGCCTGGCTGCCTCTGG - Intergenic
1131586179 15:93695181-93695203 CCACTGAGCTTGGCTGTGCCTGG + Intergenic
1131905058 15:97133971-97133993 CCACTGTGCCTGGCTGTGCCTGG - Intergenic
1132433009 15:101775688-101775710 GCACTGTGGGTGGCTGACAACGG + Intergenic
1202949674 15_KI270727v1_random:22248-22270 AAACTGTGATTGGCTGACAAAGG + Intergenic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133616816 16:7484749-7484771 CCACAGTGCCTGGCTGGCATTGG + Intronic
1134237774 16:12481087-12481109 GCACATTGCTTGGCTGACACAGG - Intronic
1134415941 16:14043444-14043466 CCACAGTGCATGCCAGACACAGG - Intergenic
1134587064 16:15420861-15420883 CCACTGTGCCTGGCCCAGACAGG + Intronic
1134676175 16:16091989-16092011 GCACTGTGGGAGGCTGACACAGG + Intronic
1135027126 16:19007110-19007132 CCACCGTGCCTGGCTGTCCCAGG + Intronic
1135519563 16:23164387-23164409 CCACTGTGCCTGGATGAAAATGG - Intergenic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1136555732 16:31006825-31006847 CCACCGCGCTCGGCTGGCACTGG - Intronic
1137439812 16:48488773-48488795 CCACTGTGCCTGCCTGAGCCCGG - Intergenic
1138970502 16:62137074-62137096 CCAGGGAGCCTGGCTGACACAGG - Intergenic
1139006320 16:62576074-62576096 CCACTGCGCCCGGCTGACATTGG - Intergenic
1139258538 16:65568057-65568079 CCACTGTGCCTGGCTAACAATGG - Intergenic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1140263309 16:73399163-73399185 CCACTGTGCCCGGCTGGCAGTGG + Intergenic
1141808804 16:86360129-86360151 CCACTGAGCATCCCTGACACAGG - Intergenic
1142571025 17:874300-874322 CCACCGTGCCCGGCTGAGACTGG - Intronic
1143017708 17:3899811-3899833 CCACTGCGCCCGGCTGAGACAGG - Intronic
1143743250 17:8969665-8969687 CCACTGTGCCTGGCTGACATTGG + Intergenic
1144024918 17:11269325-11269347 CCACTGTGCTTGGCCTGCCCAGG + Intronic
1144859349 17:18290638-18290660 CCACGGTGCTGGGCTGAAAGTGG + Exonic
1145042471 17:19587305-19587327 CCACTGCGCCTGGCTGACCCTGG - Intergenic
1145226471 17:21132654-21132676 CTGCTGTGATTGGCTGAGACTGG + Intronic
1146435366 17:32841177-32841199 CCACTGTGCCTGGCCTACAATGG - Intronic
1146943834 17:36861082-36861104 CCACCGTGCCTGGCCGACCCAGG + Intergenic
1147023926 17:37564132-37564154 CCACTGTGCCTGGCCAACCCTGG + Intronic
1147152472 17:38525999-38526021 CCACTGTGCCTGGCTTCCAGTGG + Intergenic
1147356579 17:39903108-39903130 TCACTGTGCTTGGCTGGCTAAGG - Intergenic
1147487961 17:40836568-40836590 CCACTGTGCCTGGCTAAAATGGG + Intergenic
1147617533 17:41838537-41838559 CCACTGTGCCTGGCCAACTCTGG + Intronic
1148493784 17:48039832-48039854 CCACCGTGCCCGGCCGACACTGG - Intergenic
1149226229 17:54474175-54474197 CCACTGTGCCTGGCCTACTCTGG + Intergenic
1150166295 17:62946763-62946785 CCACTGTGCCCGGCTGCAACTGG + Intergenic
1151693045 17:75698903-75698925 CCACTGTGCCTGGCCCACAATGG - Intronic
1151972294 17:77464878-77464900 CCACTGCGCCCGGCTGACACAGG + Intronic
1152033186 17:77856202-77856224 GCACTGTGGGAGGCTGACACAGG + Intergenic
1152766821 17:82145895-82145917 CCCCTGTGCTCTGGTGACACTGG - Intronic
1152814268 17:82398139-82398161 CCACCGTGCTTGCCTGAGCCAGG + Intronic
1153647781 18:7210776-7210798 CCACTGTGCCAGGCTGAGATGGG - Intergenic
1155699494 18:28725937-28725959 ACATTGTGCTTGGCTTGCACTGG - Intergenic
1157717866 18:49901448-49901470 CCCCTTTGATTGGCTGACATGGG + Intronic
1157750352 18:50172974-50172996 CCACTGCGCCTGGCCCACACTGG - Intronic
1157850903 18:51050068-51050090 CCACCGTGCCTGGCTGACAGTGG - Intronic
1158180965 18:54714450-54714472 TCAGTCTGCTTGGCTCACACAGG - Intergenic
1158631854 18:59122268-59122290 CCACTGTGCTCAGGAGACACTGG - Intergenic
1159095702 18:63899035-63899057 TGACTGTGCTTGGCTACCACTGG + Intronic
1160875217 19:1293650-1293672 CCCCTGTGCTGGGCTCACAGGGG + Intronic
1161038372 19:2097548-2097570 CCACGGGGCTTGGCTGAGGCTGG + Intronic
1161147677 19:2688776-2688798 CCACTGTGCCCGGCTAACAATGG - Intronic
1161262927 19:3347480-3347502 CCAAAGTGCTGGGTTGACACTGG - Intergenic
1161552805 19:4923475-4923497 CCCCTCTGCTTGGCTGCCCCTGG + Intronic
1161920734 19:7263743-7263765 CCACTGTGCCTGGCTGTGCCTGG - Intronic
1161937136 19:7378978-7379000 CCACTGTGCCCGGCTGACTGTGG + Intronic
1162054582 19:8055001-8055023 CCACTGTGCCTGGCTGATAGTGG - Intronic
1162210491 19:9087723-9087745 TCACTGTGCTCGGCCGACACTGG + Intergenic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162485352 19:10956968-10956990 CCACCGTGCCTGGTTGAGACAGG + Intergenic
1162706141 19:12555979-12556001 CCACCGTGCCTGGCCTACACAGG - Intronic
1163279104 19:16304280-16304302 CCACCGTGCCTGGCTGACTTTGG - Intergenic
1163332463 19:16649288-16649310 CCACTGCGCCTGGCTGAAACAGG - Intronic
1163411584 19:17158282-17158304 CCACCGTGCCTGGCTGGCAGGGG - Intronic
1163559689 19:18011418-18011440 CCACTGTGCCCGGCTGGCAGAGG + Intronic
1164011167 19:21204540-21204562 TCCCTGTGCTTGCCTGACAAAGG + Intergenic
1164015849 19:21255410-21255432 TCCCTGTGCTTGACTGACAAAGG - Intronic
1164139980 19:22451005-22451027 CCACTGCGCTCGGCCGACTCAGG - Intronic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1164930939 19:32175413-32175435 CCACCGTGCCTGGCTGATGCTGG + Intergenic
1165002775 19:32778785-32778807 CCACTGTGCCCGGATGACCCTGG + Intronic
1165053939 19:33161675-33161697 CCACTGTGCCTAGATGACAGAGG - Intronic
1165158740 19:33803630-33803652 CGGCTGTGCTTGGCTGTCTCGGG - Intronic
1165224847 19:34347512-34347534 CCACTGTGCCTGGCTGATGCTGG + Intronic
1165308748 19:35018282-35018304 CCACTGTGCCCGGCTGCCTCAGG + Intronic
1165537358 19:36460092-36460114 CCACTGTGCCTGGCTTTCATAGG + Intronic
1165861827 19:38913070-38913092 CCACTATGCTTGGCTGAGAGTGG + Intergenic
1166226729 19:41400525-41400547 CCACTGTGCCTGGCTGCGCCTGG + Intronic
1166657041 19:44619981-44620003 CCACTGCGCCTGGCCGACACTGG - Intronic
1166686285 19:44798420-44798442 CCACCGCGCTTGGCTGCCAGTGG - Intronic
1166946229 19:46398269-46398291 CCACTGTGCCTGGCTGACACTGG - Intergenic
1167094395 19:47366566-47366588 CCACTGTGCCTGGCTGACACTGG + Intronic
1167974684 19:53215462-53215484 CCAGTGTGCCCGGCCGACACTGG + Intergenic
1168144413 19:54412425-54412447 CCACTGGGCCTGGCCGAGACAGG + Intergenic
925345051 2:3166077-3166099 CCACTGCACCTGGCTGAAACTGG + Intergenic
925501751 2:4512664-4512686 CCACTGTCCTTGGCTAAATCTGG + Intergenic
925770906 2:7282282-7282304 CCACTGTGCTGGGGTAGCACTGG + Intergenic
925965605 2:9062606-9062628 CCACTGTGCCTGGCTGAGAGGGG - Intergenic
926819298 2:16835067-16835089 CCACTGTGCCTGGCTTATCCTGG + Intergenic
927675659 2:25104058-25104080 CCACTGTGCCTGGCCACCACGGG - Intronic
927806340 2:26150042-26150064 CCACCGTGCTGGGCTGACAATGG + Intergenic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
928496683 2:31840025-31840047 CCACTGTGCTTGGCCTTGACAGG - Intergenic
930396592 2:50829413-50829435 CCACTGTGCCCGGCTAACTCAGG + Intronic
930613696 2:53571313-53571335 CCACTGCGCCTGGCCGCCACAGG + Intronic
930813905 2:55571905-55571927 CCACTGCGCCTGGCCAACACTGG + Intronic
931132212 2:59349375-59349397 CCACTGTGCCCGGCTGACAATGG - Intergenic
932228001 2:70058486-70058508 GCACTTTGGTAGGCTGACACAGG - Intergenic
933722528 2:85407423-85407445 CCACCATGCCTGGCTGGCACTGG - Intronic
933897869 2:86827106-86827128 CCACTGTGCCTGGCTGACTGTGG + Intronic
934088122 2:88527178-88527200 CCACTGTGCCTGGCCTACAAGGG - Intronic
934767287 2:96886772-96886794 CCACTGTGCTTGGCCGTCTTCGG + Intronic
934869041 2:97843127-97843149 CCACTGTGCTGTGCTGCCAGTGG - Intronic
936510710 2:113143358-113143380 CCACTGCGCCTGGCCGCCACTGG - Intergenic
936908998 2:117571468-117571490 CCACTGTGCTTGGGGGACCGAGG + Intergenic
937206456 2:120239827-120239849 CCACTGAGCTTGGCAGTCATTGG + Intergenic
937865491 2:126748418-126748440 TCACTCAGCTTGGCTGTCACAGG + Intergenic
937892595 2:126950099-126950121 CCACTGTGCTTGGCCGAGACAGG - Intergenic
937930686 2:127202879-127202901 CCACTGCACCTGGCTGAAACTGG - Intronic
938007875 2:127803290-127803312 CCACTGTGCCTGGCCTACATTGG - Intronic
938721279 2:134069265-134069287 CCACCATGCCTGGCTGCCACTGG - Intergenic
942026084 2:171912321-171912343 CCACTGTGCATGGGAGCCACAGG + Intronic
942401270 2:175606081-175606103 CAACTGTGCTTGCATGACAATGG - Intergenic
942482056 2:176399135-176399157 CCACTGCCTTTGGCTTACACTGG - Intergenic
942713640 2:178866299-178866321 CCACTGTGCTGAGCTGAGATTGG - Intronic
942759644 2:179383193-179383215 CTGTTGTGCTTGTCTGACACAGG - Intergenic
943349889 2:186785131-186785153 CCACTTTTCTTGGCTGGCAGTGG - Intergenic
944725098 2:202462998-202463020 CCACTGTGCCTGGCCAACATTGG + Intronic
944803553 2:203259595-203259617 CCACTGTGCCCGGCTGCGACTGG - Intronic
945831056 2:214785427-214785449 CCACTGTGCTGGGCTGAGCTGGG - Intronic
946011719 2:216570070-216570092 CAAAAGTGGTTGGCTGACACAGG - Intronic
947151438 2:227120648-227120670 CCACTGTGCCTGGCCAGCACTGG - Intronic
947340244 2:229130738-229130760 CCACTGAGTTTAGCTAACACTGG - Intronic
948009718 2:234641852-234641874 CCACTGTGCCTGGCCAACACTGG - Intergenic
948057577 2:235020096-235020118 CCACTGAGCTGGGCAGACTCTGG + Intronic
948623467 2:239251303-239251325 CCACTGTGCCTGGCTGGGAATGG - Intronic
948802282 2:240438370-240438392 ACACTGGGCTTGGCTGCCCCAGG - Intronic
1169380043 20:5098260-5098282 CCACTGTGCCCGGCTAACTCAGG + Intronic
1169859945 20:10140873-10140895 CCACTGTACTTGGCAGACAGAGG - Intergenic
1170141517 20:13129287-13129309 CCACTGTGCCTGTCTTAAACAGG + Intronic
1170297903 20:14849491-14849513 CCACTGTGCCTGGCTGAGAGAGG - Intronic
1172008441 20:31832776-31832798 CCACTGTGCCTGGCTGAGGTGGG + Intronic
1172019077 20:31900045-31900067 CCACTGTGCCTGGCCGAATCTGG + Intronic
1172985948 20:38989398-38989420 CCACTGTGCCCGGCCGACACAGG + Intronic
1174171286 20:48619620-48619642 TCATGGTGCGTGGCTGACACTGG - Intergenic
1174295806 20:49544235-49544257 CCACTGCTCATGGCTGACACAGG + Intronic
1175850765 20:62091150-62091172 CCACTGTGCCCAGCTGAAACTGG + Intergenic
1178885975 21:36484997-36485019 CCACTGTACTGGGCTGATAAGGG + Intronic
1178907057 21:36645329-36645351 CCACTGTGGCTGGCCGAGACTGG - Intergenic
1179517971 21:41922450-41922472 CCACTGTGCTCAGCTGCCATAGG + Intronic
1179668043 21:42925952-42925974 CCACCGTGCCCGGCTGAGACAGG - Intergenic
1180653468 22:17398587-17398609 CCACAGTGCTTCTGTGACACTGG + Intronic
1180818321 22:18807155-18807177 CTCCTGTGCTTGGCTGTCATCGG + Intergenic
1181076411 22:20380744-20380766 CTGCTGTGATTGGCTGAGACTGG + Intronic
1181204545 22:21241610-21241632 CTCCTGTGCTTGGCTGTCATCGG + Intergenic
1182196923 22:28528440-28528462 CCACTGTGCCTGGCCTACACTGG - Intronic
1182377993 22:29862415-29862437 GCACTGTGCCTGGCAGACATAGG + Intergenic
1182633883 22:31709108-31709130 CCACTGTGCCCAGCTGACATGGG + Intronic
1182838101 22:33360927-33360949 CCACTGTGCCCGGCCGACATGGG - Intronic
1182841075 22:33390558-33390580 CACGTGTGCTCGGCTGACACAGG + Intronic
1182958948 22:34454047-34454069 CCACTGCACTTGACTAACACAGG - Intergenic
1183610053 22:38894866-38894888 CCACTGTGCCCGGCTGATCCTGG + Intergenic
1184185485 22:42862026-42862048 CCACTGTGCTGGGATTACAGGGG + Intronic
1184343928 22:43901477-43901499 CCACTGCGCCTGGCTGAGAGAGG + Intergenic
1184632748 22:45796784-45796806 CCACTGTGCCTGGCCTATACTGG + Intronic
1184715355 22:46278872-46278894 CCACGTTCCTTGGCTAACACTGG + Intronic
1185064267 22:48622903-48622925 GTAGTGTGCTTGGCTGTCACGGG - Intronic
1185069558 22:48648551-48648573 CTACTGCGCCTGGCTGATACGGG - Intronic
1185325444 22:50223489-50223511 CCACCGCGCTCGGCTGAGACAGG - Intronic
1185401160 22:50618099-50618121 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1203222381 22_KI270731v1_random:53805-53827 CTCCTGTGCTTGGCTGTCATCGG - Intergenic
1203268450 22_KI270734v1_random:33009-33031 CTCCTGTGCTTGGCTGTCATCGG + Intergenic
950062871 3:10086722-10086744 GCACTTTGCTAGGCTGAGACAGG - Intronic
950174774 3:10865374-10865396 CCACTGTGCCTGGCCACCACAGG - Intronic
950314622 3:11989798-11989820 CCGCTTTGATTGGCTGAGACTGG - Intergenic
950349566 3:12334518-12334540 CCACCGTGCCTGGCTGACTTGGG + Intronic
953366136 3:42346851-42346873 CCACCGTGCCTGGCCGACAAGGG + Intergenic
953859013 3:46526471-46526493 CCACTGTGCTTGGCTGTGTGTGG - Intronic
954483043 3:50819672-50819694 CCACTGTGCCTGGCTCACCATGG - Intronic
954702961 3:52461353-52461375 CCACTGAGCTTGGCAGGGACAGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955291336 3:57695012-57695034 CCACTGTGCTTGGCCACAACTGG - Intergenic
955580786 3:60419066-60419088 CCACTGTGCTCTGCTGTTACTGG - Intronic
955826694 3:62954793-62954815 CCACTGTGATTGGCTGAGACTGG + Intergenic
957885775 3:86285683-86285705 CAACTCTGCTTGGCTGAGGCAGG - Intergenic
959523379 3:107346201-107346223 CCACTGTGATTGGCTCAGTCTGG + Intergenic
959551788 3:107668288-107668310 ACACAGTGCTTGGCTAGCACAGG - Intronic
959983765 3:112549519-112549541 CCACCGCGCCTGGCTGAAACAGG - Intronic
960154995 3:114290700-114290722 CCATGGGACTTGGCTGACACTGG - Intronic
960559617 3:119069213-119069235 CCACTGTGCCTGGCCAACAATGG + Intronic
961004461 3:123395585-123395607 CCACCATGCCTGGCTGACATGGG - Intronic
961195107 3:124994789-124994811 CCACTGTGCCCAGCTGACAGTGG + Intronic
963145066 3:141985239-141985261 CCACTGTGCTTGGCCAAAATAGG - Intronic
964502996 3:157369014-157369036 GCACAGTGCTTGGCACACACAGG + Intronic
964546370 3:157838806-157838828 CCACTGTGCCTGGCTGTCACTGG - Intergenic
965115425 3:164482001-164482023 CCACTGTGCCTGGCTGACTGAGG + Intergenic
966542912 3:181111689-181111711 CCACTGTGCCTGGCTGATGGTGG - Intergenic
967447985 3:189589332-189589354 CCATTGTGCATAGCTGCCACTGG - Intergenic
967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG + Intronic
968204036 3:196782734-196782756 AAACTGTGATTGGCTGACAAAGG - Exonic
968668580 4:1835155-1835177 CCACTGTGCCCGGCCCACACGGG - Intronic
969118376 4:4888794-4888816 CCTCTATGCCTGGCCGACACTGG + Intergenic
970009432 4:11443127-11443149 CCCCTGTGCTTTTCTGTCACTGG + Intergenic
970197011 4:13561099-13561121 CCACCGTGCCTGGCCGCCACAGG + Intergenic
970323729 4:14901230-14901252 CCACTGTCCATGGCTGAGCCGGG - Intergenic
970603651 4:17659771-17659793 CCACCGTGCCTGGCTGCAACAGG + Intronic
970938675 4:21605765-21605787 CCACTGTGCCTGGCGTACAATGG + Intronic
971029279 4:22619601-22619623 CCACTGTGCCTGGCTGAGGAAGG + Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
973019729 4:45187646-45187668 CCACTGTGCCTGGCTGCTCCTGG - Intergenic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974053781 4:56965288-56965310 CCACTGCGCTTGGCTGTAACTGG + Intronic
975869788 4:78767235-78767257 CCACTGCGCCTGACCGACACTGG + Intergenic
976800785 4:88989312-88989334 CCACTGTGCCTGGCCAACTCAGG - Intronic
977696031 4:99967475-99967497 CCACTGTGCCTGGCCCACATTGG + Intergenic
980884346 4:138745992-138746014 CCACTTTGCCTGGCCGACACAGG - Intergenic
981540783 4:145844390-145844412 CCACCGTGATTCGCTCACACTGG - Intronic
981697757 4:147575708-147575730 CCACCATGTCTGGCTGACACTGG + Intergenic
982125730 4:152182403-152182425 CCACTGTGCCTGGCCAACTCTGG + Intergenic
982550877 4:156797781-156797803 CTGCTGTGATTGGCTGAGACTGG + Intronic
982751322 4:159165878-159165900 CCACTGTGCCTAGCTAACAATGG + Intronic
982859877 4:160435088-160435110 CCATCCTGCCTGGCTGACACTGG + Intergenic
982996317 4:162352118-162352140 GCACTTTGGTTGGCTGAGACAGG - Intergenic
983858511 4:172675406-172675428 CCACTGTGGTGAGCTGCCACAGG - Intronic
984002927 4:174272460-174272482 CAATTGTGGTTGGATGACACTGG + Intronic
985482890 5:128475-128497 CCACTGTATTTGGATGACAGGGG + Intergenic
986164891 5:5264854-5264876 CCACAGGCCCTGGCTGACACTGG - Intronic
986775965 5:11013941-11013963 CCAGGGTGCTTTGCTTACACAGG + Intronic
987324435 5:16799779-16799801 CCACTGTGCCCGGCTGAGAAAGG + Intronic
988327206 5:29785949-29785971 CCACTGTGCCTGGCCTACACTGG - Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
989770491 5:45139175-45139197 CCACTGAGCTAGACAGACACTGG + Intergenic
990460771 5:56029030-56029052 CCACTGTGCCCGGCTGACTCTGG - Intergenic
991201888 5:64004288-64004310 CTACTGTCCTTGGAGGACACAGG + Intergenic
991264440 5:64700657-64700679 GCACTTTGGTAGGCTGACACAGG - Intronic
991714269 5:69436949-69436971 CCACTGTGCCTGGCCGAGATGGG - Intronic
992333710 5:75743416-75743438 CCACTGTGCCTGGCCAACACTGG + Intergenic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
996732822 5:126732180-126732202 CCACTGCACCTGGCTGACATGGG - Intergenic
997261071 5:132465871-132465893 CCACCGTGCCGGGCTGACAGTGG + Intronic
997990295 5:138539220-138539242 CCACTGTCCCTGGCTAGCACAGG + Intronic
998047273 5:138998453-138998475 CCACTGTGCTCAGCTGAGGCTGG + Intronic
998443670 5:142182180-142182202 CCACTGTGCCTGGCCGGGACTGG - Intergenic
999149786 5:149419256-149419278 CCACTGTGCCTGGCTGAATTAGG - Intergenic
999193064 5:149763070-149763092 CCACTGTGCCTGGCTCACCAAGG + Intronic
999222816 5:149995574-149995596 CCAGTGGGCTTGGATGACAAGGG - Exonic
999908015 5:156164774-156164796 ACACTGTGCTTGGCTTTCAGAGG + Intronic
1000425071 5:161080623-161080645 CCACTGCGCCCGGCCGACACAGG + Intergenic
1001130959 5:169063163-169063185 CCTCTGTGCAGGGCTGGCACGGG - Intronic
1001722692 5:173869562-173869584 CCAGTGTGCATGGCTGAGAATGG - Intergenic
1001930300 5:175668194-175668216 CCACAGTGCTTGGCCCACACTGG - Intronic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1002567892 5:180122451-180122473 CCACTGCGCTTGGCCTACCCTGG - Intronic
1002659341 5:180780614-180780636 GCACTGTGGGAGGCTGACACAGG + Intergenic
1003152138 6:3561837-3561859 CTACTGTGCTGGGCTGAAAAGGG - Intergenic
1003409305 6:5849364-5849386 CCGCTGTCCTAGGCTGACTCAGG + Intergenic
1005685940 6:28252940-28252962 CCACTGTGCTTGACTGTGATTGG - Intergenic
1006105162 6:31712076-31712098 CCAGTGACCTGGGCTGACACGGG + Exonic
1007074622 6:39058547-39058569 CCACGGTGCCTGGGTGAAACTGG - Intronic
1007539644 6:42629302-42629324 CCACTGTGCCCGGCTGATAGTGG + Intronic
1007757192 6:44107496-44107518 CCACCGTGCCTGGCTGAGATGGG - Intergenic
1008364794 6:50665325-50665347 CCACTGTGCCTGGCCAACAGAGG - Intergenic
1009416793 6:63424633-63424655 CCACTGTGCCTGGCTTTTACTGG - Intergenic
1010422786 6:75693110-75693132 CCACTGTGCCTGGCCTACAATGG - Intronic
1012020177 6:93908209-93908231 CCACTGTGCCTGGCTGAAATAGG - Intergenic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1012952559 6:105534410-105534432 TCATTGTGCCTGGCTGCCACAGG + Intergenic
1013318057 6:108960251-108960273 AGACTGTGCTTGGCAGAGACTGG - Intronic
1013755681 6:113459034-113459056 CCACTGTGCCTGGCCCACCCTGG - Intergenic
1013885317 6:114958174-114958196 CCACTGTGCTTGGCCTAAATTGG - Intergenic
1013987910 6:116219000-116219022 CCACTGTGCCTGGCCACCACTGG - Intronic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1016967859 6:149735342-149735364 CCAATGTGCCTGGCTTAAACTGG + Intronic
1018488958 6:164272228-164272250 CCAGTTTACTTGGTTGACACAGG - Intergenic
1021090180 7:16473816-16473838 CCACTGTGCTCAGCTGATATTGG - Intronic
1021470412 7:20996166-20996188 CCACAGCGCCTGGCTGAGACTGG + Intergenic
1022123818 7:27336540-27336562 CCACTGTGCCTGGCTAAAGCAGG - Intergenic
1023112173 7:36824843-36824865 CCACTGTACTTGGCCAGCACTGG + Intergenic
1023430643 7:40087428-40087450 CCACTGTGCCTGGCTGGAAATGG + Intronic
1024706976 7:51971730-51971752 GCTCTGTGTTTGGCAGACACTGG + Intergenic
1025998686 7:66544561-66544583 CCACTGTGCCTGGCTGTAGCTGG - Intergenic
1026289122 7:68990128-68990150 CCACTGCGCCTGGCTGGGACTGG - Intergenic
1026856602 7:73759139-73759161 CCACCGTGCCTGGCTGTCCCTGG - Intergenic
1026991642 7:74589408-74589430 CCACTGTGCCTGGCTGCAGCTGG - Intronic
1027059230 7:75072690-75072712 CCACTGTGCCTGGCTGAAAGAGG - Intronic
1027146097 7:75695860-75695882 CCACCGTGCCTGGCTGGTACTGG + Intronic
1027227629 7:76254306-76254328 CCACTGTGCCTGGCTGAACTGGG + Intronic
1028449412 7:90963999-90964021 CCACTGTGCCTGGCCGACAAAGG + Intronic
1028832255 7:95340883-95340905 CCTCTGTGCTGAGCTGTCACAGG + Intergenic
1029077549 7:97947731-97947753 CACCTGTGCTGGGCTGACATCGG - Intergenic
1029158649 7:98535271-98535293 CCACTGAGCCTGGCTGATTCAGG + Intergenic
1029379900 7:100206301-100206323 CCACTGTGCCTGGCTGCCTAAGG + Intronic
1030947090 7:115737064-115737086 CCACTGTGCTTGGCCTATAGTGG + Intergenic
1031832737 7:126647102-126647124 CCACTGTGCTTGGCTCCTAAAGG - Intronic
1032287775 7:130555537-130555559 CCACCGTGCCTGGCTGACACTGG - Intronic
1032850249 7:135788871-135788893 CCACGGTGTTTGGCTGATTCTGG + Intergenic
1032913839 7:136464369-136464391 ACTCTGTGATTGGCTGATACAGG - Intergenic
1033183337 7:139202076-139202098 CCACTGTGCCTGGCTGGTAAAGG - Intergenic
1033876245 7:145822444-145822466 CCACTGTGCTCTGCTGACTCTGG - Intergenic
1034152810 7:148929951-148929973 GCACGGTGCCTGGCTGAGACAGG - Intergenic
1034510908 7:151533866-151533888 CCACCGTGCCAGGCTGAGACAGG + Intergenic
1037330301 8:17737344-17737366 GCACTGTGCTTGGCGCACACAGG + Intronic
1037458656 8:19087142-19087164 CCACTGGCCTTGGCTGACCGTGG + Intergenic
1037814770 8:22106357-22106379 ACACTTTGGTAGGCTGACACAGG - Intergenic
1038184942 8:25264536-25264558 CCACTGTGCCTGGCTGCCTTAGG - Intronic
1038214006 8:25545182-25545204 CCACTGTGCCCAGCTGAGACTGG + Intergenic
1038294332 8:26277149-26277171 CCACAGTGCTAGGCTGACAGAGG + Intergenic
1038559707 8:28562409-28562431 CCACTCTTCTTGGCTGCCAGGGG + Intronic
1039046972 8:33459351-33459373 CCACTGCGCCTGGCTTCCACAGG - Intronic
1039470212 8:37808662-37808684 CCACTGTGCCTGGCTGGGTCTGG - Intronic
1040496667 8:47971942-47971964 TCACTGTACCTGGCTGACAATGG - Intronic
1043294125 8:78643182-78643204 CCACTGTGTCTGGCTGAGAATGG + Intergenic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1044574816 8:93756786-93756808 CCACTGTGCCTGGCCTATACAGG - Intronic
1047749581 8:127870089-127870111 CCACTGTGCCTGGTGGACATTGG + Intergenic
1048159448 8:132000413-132000435 CCACTGTGCCTGGCCGACTTGGG + Intronic
1048942426 8:139413255-139413277 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1049812694 8:144582569-144582591 CCTCTGTGTTTGGATGCCACAGG + Intronic
1049829455 8:144691025-144691047 CCACTCTGCTGGGATGGCACTGG + Intergenic
1049871905 8:144986156-144986178 CCACTGCACCTGGCTGACAATGG + Intergenic
1052021560 9:23531274-23531296 CCACTGGGCTTCACTGCCACAGG - Intergenic
1053239193 9:36482638-36482660 CCACTGCGCCAGGCTGACAGTGG + Intronic
1054786729 9:69217419-69217441 CCACTGTGCTTAGTTCACAGAGG - Intronic
1055289315 9:74766621-74766643 CCACTGTGCCCGGCTGACCCAGG - Intronic
1056777496 9:89524285-89524307 CCTTTGCTCTTGGCTGACACGGG - Intergenic
1056879987 9:90381674-90381696 CTACTAAGCTAGGCTGACACAGG + Intergenic
1057770909 9:97967177-97967199 CCACTGTGCCCGGCCGCCACAGG + Intergenic
1057920608 9:99093652-99093674 GCACTGTGATTGGCTGAACCTGG - Intergenic
1060294480 9:122333882-122333904 CCACTGTGCCTGGCCAACAATGG - Intergenic
1060739355 9:126088099-126088121 CCACTGGCCTGGGCTGTCACTGG + Intergenic
1061063172 9:128260959-128260981 CAACTGTGGGTGGCTGACAACGG + Intronic
1061308102 9:129744134-129744156 CCACTGTGCTTGACTGAGTAGGG + Intronic
1061745230 9:132734487-132734509 GCACTGTGGAAGGCTGACACAGG + Intronic
1061939945 9:133878602-133878624 CCTCTGTGCATGTCTGTCACAGG + Intronic
1062041616 9:134406997-134407019 CCACTGTGCTGAGTTGTCACGGG + Intronic
1062176253 9:135164633-135164655 CCACTGCCCTGGGCTGACATGGG - Intergenic
1062409830 9:136417898-136417920 CCACTGTGCCTGGCTGGCATTGG + Intronic
1062459404 9:136656621-136656643 CCACTGTGCCTTGCGGAGACTGG + Intergenic
1062542331 9:137047095-137047117 CCACTGTGCCCAGCTGACAACGG + Intergenic
1062630464 9:137460988-137461010 TCAGGGTGCTTGGCTGACAAGGG - Intronic
1186551794 X:10513794-10513816 CCACTGTGCCTGGCCAACAATGG + Intronic
1186880922 X:13865442-13865464 CCACCGTGCCTGGCTGAGAATGG - Intronic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189481931 X:41398657-41398679 CCACTGTGCCTGGCTGAAAATGG + Intergenic
1189820413 X:44865263-44865285 CCACTGTGCCTGGCCTGCACTGG + Intergenic
1189852716 X:45193064-45193086 CCACTGTGCCTGGCAGGCATTGG + Intronic
1189990833 X:46592648-46592670 CCACTGTACCTGGCTGATAGAGG + Intronic
1190273746 X:48886753-48886775 CCACTGTGCCCGGCCAACACAGG - Intergenic
1190580032 X:51883370-51883392 CCACTCTGCTTGGGAGAGACTGG - Intronic
1191776933 X:64824585-64824607 CCACTGTGCATGGCTGAAATTGG - Intergenic
1192699071 X:73448247-73448269 TCACAGTGCTTGGCTGGCAACGG + Intronic
1192762828 X:74112521-74112543 CCCCTATGCTTGCCTGACTCTGG - Intergenic
1193403655 X:81076513-81076535 CCAATAAACTTGGCTGACACGGG + Intergenic
1195893190 X:109718465-109718487 CCACTGCGCCTGGCTGACTATGG - Intronic
1197696463 X:129555187-129555209 CCACTGTGCTTGGCCACCAGAGG - Intronic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic
1202366915 Y:24171904-24171926 GCACTGTGGGTGGCTGACAATGG - Intergenic
1202373492 Y:24213578-24213600 GCACTGTGGGTGGCTGACAATGG + Intergenic
1202497289 Y:25456542-25456564 GCACTGTGGGTGGCTGACAATGG - Intergenic
1202503867 Y:25498219-25498241 GCACTGTGGGTGGCTGACAATGG + Intergenic