ID: 967562990

View in Genome Browser
Species Human (GRCh38)
Location 3:190939332-190939354
Sequence CTGCAGTTCTTGCCTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967562984_967562990 -10 Left 967562984 3:190939319-190939341 CCCCCATGGGTCCCTGCAGTTCT No data
Right 967562990 3:190939332-190939354 CTGCAGTTCTTGCCTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967562990 Original CRISPR CTGCAGTTCTTGCCTGAAGA AGG Intergenic
No off target data available for this crispr