ID: 967570740

View in Genome Browser
Species Human (GRCh38)
Location 3:191025661-191025683
Sequence TAAAATTATCCCCATGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967570740_967570745 26 Left 967570740 3:191025661-191025683 CCAGCCCCATGGGGATAATTTTA No data
Right 967570745 3:191025710-191025732 TCATTCCCTTAGCCATTTAATGG No data
967570740_967570744 -2 Left 967570740 3:191025661-191025683 CCAGCCCCATGGGGATAATTTTA No data
Right 967570744 3:191025682-191025704 TAACAAGTCTAAGTCAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967570740 Original CRISPR TAAAATTATCCCCATGGGGC TGG (reversed) Intergenic
No off target data available for this crispr