ID: 967579003

View in Genome Browser
Species Human (GRCh38)
Location 3:191129815-191129837
Sequence CGGTTGATGCAAAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967579003_967579014 29 Left 967579003 3:191129815-191129837 CCTTCCACCCTTTGCATCAACCG No data
Right 967579014 3:191129867-191129889 AGAGCTGTTGGAAGAGAGGCAGG No data
967579003_967579012 17 Left 967579003 3:191129815-191129837 CCTTCCACCCTTTGCATCAACCG No data
Right 967579012 3:191129855-191129877 CTAATACTTATAAGAGCTGTTGG No data
967579003_967579013 25 Left 967579003 3:191129815-191129837 CCTTCCACCCTTTGCATCAACCG No data
Right 967579013 3:191129863-191129885 TATAAGAGCTGTTGGAAGAGAGG No data
967579003_967579015 30 Left 967579003 3:191129815-191129837 CCTTCCACCCTTTGCATCAACCG No data
Right 967579015 3:191129868-191129890 GAGCTGTTGGAAGAGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967579003 Original CRISPR CGGTTGATGCAAAGGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr