ID: 967582913

View in Genome Browser
Species Human (GRCh38)
Location 3:191180313-191180335
Sequence CTGTATTAGCAGTGTGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967582911_967582913 19 Left 967582911 3:191180271-191180293 CCAGTCTCATGTATTACTGTCTT No data
Right 967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG No data
967582910_967582913 20 Left 967582910 3:191180270-191180292 CCCAGTCTCATGTATTACTGTCT No data
Right 967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967582913 Original CRISPR CTGTATTAGCAGTGTGAGGA CGG Intergenic
No off target data available for this crispr