ID: 967586938

View in Genome Browser
Species Human (GRCh38)
Location 3:191225467-191225489
Sequence GTCAATATGACACTTGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967586938_967586942 10 Left 967586938 3:191225467-191225489 CCTGAAACAAGTGTCATATTGAC 0: 1
1: 0
2: 0
3: 10
4: 119
Right 967586942 3:191225500-191225522 CCAAAAACTACATTTAAACAAGG 0: 1
1: 0
2: 4
3: 51
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967586938 Original CRISPR GTCAATATGACACTTGTTTC AGG (reversed) Intronic
908201411 1:61799488-61799510 GTCAATATGGCATTTGTGCCAGG - Intronic
911275867 1:95856872-95856894 GTCAGTATGATACTTGCTTAAGG - Intergenic
911995389 1:104759126-104759148 GGCAATATGTCACTTTTTTAGGG + Intergenic
912371332 1:109176541-109176563 GTAAATATGACTTTTGTTTTAGG - Intronic
917600521 1:176569400-176569422 GTGAATATGACATCTCTTTCAGG + Intronic
917672299 1:177284257-177284279 ATCAATATGATACTTGCATCTGG - Intergenic
917811507 1:178662912-178662934 GTTAACATGACATTTTTTTCTGG - Intergenic
918004204 1:180526505-180526527 GTGAATATGAAACTTATCTCGGG - Intergenic
919494971 1:198253321-198253343 CTCCATACTACACTTGTTTCTGG - Intronic
919562641 1:199141006-199141028 CTCAATATTACAATTATTTCAGG - Intergenic
921879235 1:220235315-220235337 CACAATAAGACAATTGTTTCTGG - Intronic
1063793235 10:9479361-9479383 GTGAATATTACTTTTGTTTCTGG + Intergenic
1070898197 10:80003997-80004019 GTCAAAATGAAAATTTTTTCTGG + Intergenic
1075629003 10:123988705-123988727 TTCAATATGAGACTTGGTTGGGG - Intergenic
1077204322 11:1335016-1335038 GTCTATAAGAGACTTGTATCTGG - Intergenic
1078037065 11:7817586-7817608 TTCAGTATGACACTTGTTGTGGG - Intergenic
1080219537 11:29885303-29885325 GGCAATATGACAGATTTTTCTGG - Intergenic
1080970245 11:37265514-37265536 ACCACTATGACAGTTGTTTCAGG + Intergenic
1084298499 11:68228855-68228877 GTGAAAAGGACACTTGTTTACGG + Intergenic
1087144299 11:94797028-94797050 GTGAATATGACACTTCTATCTGG + Intronic
1088621575 11:111689843-111689865 GTCAATATTACATATGTTACAGG + Intronic
1094631014 12:32173907-32173929 TTCAATATGAAAATAGTTTCTGG - Intronic
1095179501 12:39131069-39131091 ATCAATATGAGACTTGCATCAGG - Intergenic
1098899483 12:76098233-76098255 GGCTAAATGTCACTTGTTTCAGG + Intergenic
1103208893 12:119152656-119152678 GTCAAGATGAAACCTGTTTTTGG - Intronic
1109323816 13:60842884-60842906 GTCTATATTTCACTTGTCTCTGG + Intergenic
1109616815 13:64845679-64845701 GTCAAAATGCCTATTGTTTCTGG + Intergenic
1109782617 13:67131811-67131833 GTCTCAACGACACTTGTTTCAGG - Intronic
1116277456 14:42854119-42854141 GTCAATGTGGCTCTTGATTCAGG + Intergenic
1116463204 14:45201683-45201705 TTGAATAAGTCACTTGTTTCTGG - Intergenic
1128065095 15:64759533-64759555 GACAAACTGACATTTGTTTCAGG + Intronic
1129947583 15:79553799-79553821 ATCAATATGAAATTTGTTTGGGG - Intergenic
1133143038 16:3762275-3762297 ACCAAAGTGACACTTGTTTCAGG - Intronic
1140377328 16:74455058-74455080 GTCAATATAAGTCTTGTTTGCGG - Intronic
1143401357 17:6646523-6646545 TTCAATATAGCACATGTTTCTGG - Intronic
1150453339 17:65287657-65287679 GTCAACATACAACTTGTTTCTGG + Intergenic
1152784059 17:82238959-82238981 GCCACTCAGACACTTGTTTCCGG - Exonic
1153090273 18:1335038-1335060 GGAAATATGACACTTCTATCAGG - Intergenic
1156319634 18:36006923-36006945 GCCTATATGACACCTGCTTCTGG + Intronic
1158026873 18:52909559-52909581 GTCTATGTGAAACTTATTTCAGG + Intronic
1158721301 18:59927531-59927553 GTCAGAATGAAACATGTTTCTGG + Intergenic
1159031302 18:63235117-63235139 GCCAATCTGATAGTTGTTTCAGG - Intronic
1159600649 18:70425745-70425767 GGTAATATGACACTAGTTACTGG + Intergenic
1160288248 18:77566998-77567020 GTAAATATGACATTGGTTTCGGG - Intergenic
1162188039 19:8922497-8922519 GTGAATATGACCCTAGTCTCTGG - Intronic
1164086935 19:21911546-21911568 GGAAATATGACACTTTTTTCTGG + Intergenic
1165568563 19:36755081-36755103 GTCAGTATGAGACCAGTTTCTGG - Intronic
1168558917 19:57366735-57366757 TTGACTATGACATTTGTTTCTGG - Intronic
925313342 2:2903544-2903566 GTCAGAATGAACCTTGTTTCAGG + Intergenic
926869447 2:17396882-17396904 CTCCATATGACACTTCTTACTGG + Intergenic
927116325 2:19905750-19905772 GCCAATAACACACTTGTTTTGGG - Intergenic
927449072 2:23191014-23191036 GTCAACATAACACTAGTGTCAGG - Intergenic
928235974 2:29540932-29540954 GACAATCTGACACATATTTCTGG - Intronic
929790775 2:45021211-45021233 TTCAATGTGCCACATGTTTCTGG + Intergenic
930165858 2:48203245-48203267 GGGAATAAGGCACTTGTTTCTGG - Intergenic
931657056 2:64518855-64518877 TTCAAGGTGACAATTGTTTCAGG + Intergenic
932443539 2:71755719-71755741 ATCGGTATGTCACTTGTTTCTGG - Intergenic
933247595 2:79993553-79993575 GACAAAATGACAAATGTTTCAGG + Intronic
934899659 2:98148778-98148800 TTCTATATGACACTTGCTCCTGG + Intronic
937277312 2:120693241-120693263 TTCAATAACACCCTTGTTTCTGG - Intergenic
940704849 2:157091800-157091822 CTTAATATGACATTTGATTCTGG + Intergenic
943990785 2:194689384-194689406 GTAAAAAGGACACTTGTTTATGG - Intergenic
945154929 2:206828482-206828504 CTCAACATGACACTTCTGTCTGG + Intergenic
948045427 2:234940153-234940175 GGCAATGGGACACTGGTTTCTGG - Intergenic
949151667 3:775666-775688 GTCTAGATGACACATGTCTCTGG + Intergenic
950108382 3:10402958-10402980 GCCAATATTACACTTGCTTTAGG + Intronic
951279307 3:20728276-20728298 TTCAATATGACACTAGTTATGGG + Intergenic
951695284 3:25440149-25440171 GTCAATAAGAAACTTGTTTTAGG + Intronic
952566337 3:34662941-34662963 TTCAAGATGATACTTTTTTCTGG - Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
960259258 3:115546984-115547006 GTGAATATGAAACCAGTTTCTGG - Intergenic
960833332 3:121875421-121875443 GTGATTATGAAACCTGTTTCTGG + Intronic
964469121 3:157032998-157033020 GTTACTATTACACTTGTTTGTGG + Intronic
964743788 3:159992697-159992719 CTCACTGTGACACTTGCTTCTGG - Intronic
965494285 3:169378662-169378684 GTCAAAATGACACATTTTTTTGG + Intronic
967586938 3:191225467-191225489 GTCAATATGACACTTGTTTCAGG - Intronic
967601383 3:191393321-191393343 TTCAATATGGCATTTGTTTAGGG + Intronic
976218286 4:82735106-82735128 ATCAAAATGACACTTTTTTGAGG - Intronic
977955641 4:103022701-103022723 GGAAATATGACACTTCTTTCAGG + Intronic
979086569 4:116418088-116418110 ATCAATAGGAGATTTGTTTCAGG + Intergenic
979200884 4:117977140-117977162 GTCAATACAACACTTATTTGAGG + Intergenic
983158084 4:164376854-164376876 GTCAATCTCACATCTGTTTCTGG - Intronic
984065400 4:175042123-175042145 TCCAATATCACAATTGTTTCAGG + Intergenic
989525119 5:42444525-42444547 GTCAAAATGGCAATTATTTCAGG - Intronic
994672128 5:102775229-102775251 GTCAATATGACACTATTCTTTGG + Intronic
995374331 5:111456757-111456779 GTAAATATGACACTTCCTACTGG + Intronic
995409330 5:111836864-111836886 ATGAATAAGACACTTCTTTCTGG + Intronic
995425157 5:112013058-112013080 AACAATATGCCAATTGTTTCAGG + Intergenic
996263166 5:121499674-121499696 GACAATGTGACATTTGTTTCAGG + Intergenic
996285259 5:121783616-121783638 GTGAGTATGCCACTTGTTCCTGG - Intergenic
998654688 5:144164324-144164346 GTCATTTTGTCTCTTGTTTCAGG - Intronic
998845095 5:146300709-146300731 GCCAACAGGACACTTTTTTCAGG + Intronic
1002189423 5:177471033-177471055 GTCAATATCACACATACTTCTGG - Intronic
1003101201 6:3177646-3177668 GTCAAAATGACAGATGTTTTAGG - Intergenic
1008351517 6:50497173-50497195 GTCATGATGGCACTTTTTTCTGG - Intergenic
1008467876 6:51851008-51851030 TTCAATATGACATTTGTTGTGGG + Intronic
1010602648 6:77849808-77849830 GTCAATATGTCACTTTTTGGTGG + Intronic
1010803466 6:80205878-80205900 GTCAACATGCCACTCATTTCAGG - Intronic
1011196806 6:84789111-84789133 GTAAATTTTACATTTGTTTCTGG - Intergenic
1011771280 6:90676208-90676230 GAGAATATGACACATGTTTGGGG + Intergenic
1012327083 6:97934282-97934304 TTAAATATGACAGTTCTTTCAGG + Intergenic
1014084235 6:117324379-117324401 GTAAGTATGAAACTTGTTTCTGG + Exonic
1015126429 6:129760318-129760340 TTGTATATGACACTTGTTTGTGG - Intergenic
1015875813 6:137821445-137821467 GTAATTATTACACTTGTTACAGG + Intergenic
1029585952 7:101471338-101471360 GTCTAGATGACACTCCTTTCCGG - Intronic
1030840012 7:114339063-114339085 CTCAATAGTACACTTTTTTCTGG - Intronic
1033755827 7:144397851-144397873 CTTAATATGACAGATGTTTCTGG + Intronic
1034380543 7:150688507-150688529 GTCACTATGACACATGTATCAGG + Intronic
1034778803 7:153858285-153858307 GGGAATAAGAAACTTGTTTCTGG - Intergenic
1035582988 8:751959-751981 GTTCATCTGACACTTTTTTCAGG + Intergenic
1037483476 8:19326389-19326411 GACAATATGGCAGTGGTTTCTGG + Intronic
1046489351 8:114929180-114929202 GGCAATATGACATTTCTTTCTGG + Intergenic
1052943216 9:34146756-34146778 CTCAATATTACACTGGTTCCAGG + Intergenic
1056119621 9:83474517-83474539 GTTTAAATGACACCTGTTTCTGG + Intronic
1057917660 9:99069623-99069645 TTCAAAATGACACTTCTTTGTGG - Intronic
1058558115 9:106192140-106192162 TTCAATATGACACTAGTTATGGG + Intergenic
1059258790 9:112956029-112956051 GCCATTGTGACACTTGTTCCTGG + Intergenic
1186115706 X:6303355-6303377 TTCAATATTTCACTTGTTTAAGG - Intergenic
1186321756 X:8435088-8435110 GCCAAAATGACACTATTTTCTGG + Intergenic
1187502088 X:19847319-19847341 GGCAATATGACTTTTCTTTCAGG - Intronic
1188441208 X:30216467-30216489 CTCTATATGGCACTTCTTTCTGG - Intronic
1189105311 X:38229521-38229543 GCCAATAAGACACTTGCTTAGGG + Intronic
1190451551 X:50586490-50586512 TTCAATATGACCCTTCATTCTGG - Intergenic
1193022886 X:76811193-76811215 TTCAATATGGCACTTGTTGTTGG - Intergenic
1193964769 X:87972199-87972221 GTCAATACAGCACATGTTTCTGG - Intergenic
1195108117 X:101619633-101619655 GTCAATATGTCACAACTTTCTGG + Intergenic
1196063875 X:111441461-111441483 GTCAATAAGACTTTTGTTTAAGG - Intergenic
1199099889 X:143787148-143787170 GTTAATATGACAGTTATTGCAGG - Intergenic
1201060565 Y:10040444-10040466 GTAAATTTGACACTTTTTTTTGG - Intergenic
1201481259 Y:14441724-14441746 TTCAATATTTCACTTGTTTATGG + Intergenic