ID: 967588188

View in Genome Browser
Species Human (GRCh38)
Location 3:191239717-191239739
Sequence ATTGGTTACCACTTAATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967588188_967588193 24 Left 967588188 3:191239717-191239739 CCATTTATTAAGTGGTAACCAAT 0: 1
1: 0
2: 1
3: 12
4: 158
Right 967588193 3:191239764-191239786 ACTCCTGTTAGGAAAAAAATTGG 0: 1
1: 0
2: 0
3: 28
4: 273
967588188_967588192 13 Left 967588188 3:191239717-191239739 CCATTTATTAAGTGGTAACCAAT 0: 1
1: 0
2: 1
3: 12
4: 158
Right 967588192 3:191239753-191239775 TATGTGAAGGAACTCCTGTTAGG 0: 1
1: 0
2: 0
3: 7
4: 148
967588188_967588190 0 Left 967588188 3:191239717-191239739 CCATTTATTAAGTGGTAACCAAT 0: 1
1: 0
2: 1
3: 12
4: 158
Right 967588190 3:191239740-191239762 TGTTTCTGTCCTCTATGTGAAGG 0: 1
1: 0
2: 2
3: 23
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967588188 Original CRISPR ATTGGTTACCACTTAATAAA TGG (reversed) Intronic
902062890 1:13659663-13659685 ATTTGTGACCATGTAATAAAGGG + Intergenic
902509469 1:16958373-16958395 CCTGTTTACCACTTAATCAATGG - Intronic
907867928 1:58417091-58417113 ATTGGAAAGCACTTAGTAAAGGG + Intronic
908044695 1:60155909-60155931 CTTAGTGAGCACTTAATAAATGG + Intergenic
909118052 1:71565084-71565106 TCTGGTTACCTCTCAATAAATGG - Intronic
913150749 1:116040399-116040421 CTTGATTAACACTTAATAAATGG - Intronic
915935285 1:160087082-160087104 ATAGCTCACCACTTCATAAAGGG - Intronic
916623135 1:166523735-166523757 ATTGGTTACGATTTTTTAAATGG + Intergenic
918710941 1:187729263-187729285 AGTGGTTACTACGGAATAAATGG + Intergenic
918841294 1:189543049-189543071 ATTGGGTTCCACTTAAAAAGTGG - Intergenic
918981583 1:191567536-191567558 ATTGTTTACTACTAAATAATTGG - Intergenic
919166643 1:193904327-193904349 TTTGGTTATCTTTTAATAAATGG - Intergenic
919248557 1:195021506-195021528 ATTGTTTATGTCTTAATAAAAGG - Intergenic
919556684 1:199064069-199064091 ATGTGTTACCACTAAATATATGG - Intergenic
920852830 1:209640245-209640267 AATGGGTACTACTTTATAAAGGG - Intronic
921590082 1:216992823-216992845 CATGGTTAGCACTTAATTAATGG - Intronic
924419994 1:243899008-243899030 ATTAGGTACCACTTTATAAAGGG - Intergenic
1063991099 10:11564198-11564220 ACTTGTTACCCCTTAACAAAAGG - Intronic
1068098003 10:52516150-52516172 ATTAGTTTCCATTCAATAAAAGG + Intergenic
1068803264 10:61165440-61165462 CATGGTGAACACTTAATAAATGG + Intergenic
1068844596 10:61657868-61657890 ACTGGGTGCCACTTAATTAATGG - Intergenic
1070364962 10:75727945-75727967 ATTTTTTTCCCCTTAATAAAGGG + Intronic
1074916678 10:117963581-117963603 ATTGGGTACCACAAAATTAAGGG - Intergenic
1085224233 11:74905040-74905062 AATAGTAACAACTTAATAAAGGG - Intronic
1092370618 12:7914010-7914032 AATGGTTACCTCTGAATAATGGG - Intergenic
1094382020 12:29853358-29853380 AGGGGTTCCCATTTAATAAATGG + Intergenic
1095391419 12:41711445-41711467 ATTAGATATCAGTTAATAAAGGG + Intergenic
1097534058 12:60843051-60843073 ATTGGTTATTAATTGATAAATGG - Intergenic
1098420935 12:70297064-70297086 ATTGGCTACACCTTGATAAAAGG + Intronic
1098533665 12:71570414-71570436 ATTGTCTACCTCTTAATAGAGGG - Intronic
1098819998 12:75215110-75215132 ATTCGCTTACACTTAATAAATGG - Intergenic
1099175363 12:79415206-79415228 ATTGGTTATCTCTTAATGGAAGG - Intronic
1101696730 12:107134095-107134117 CATTGTAACCACTTAATAAAAGG + Intergenic
1103006085 12:117421461-117421483 ATTAGTTAGAACTTAATAAATGG + Intronic
1103069461 12:117928741-117928763 ATTGGTTTCCACTAAATATAAGG - Intronic
1105656485 13:22445860-22445882 GTAAGTAACCACTTAATAAAGGG - Intergenic
1106363768 13:29057970-29057992 ATTTGTTACCACTAGATAAGAGG - Intronic
1107000208 13:35535371-35535393 CTTATTTACCACTTACTAAACGG - Intronic
1108383554 13:49877246-49877268 ATTCATTTCCAATTAATAAATGG + Intergenic
1109591762 13:64493036-64493058 ACTGGTAACCACTGAAGAAAAGG + Intergenic
1110056599 13:70982098-70982120 ACTGGTTACCACAAAATTAATGG + Intergenic
1113516250 13:110902667-110902689 TCTGGTTACCACAGAATAAATGG + Intronic
1115391361 14:32857874-32857896 ATTAGATACCACTTTAAAAATGG + Intergenic
1117229563 14:53701837-53701859 TATGGTTACCACTCAACAAATGG + Intergenic
1118353757 14:64993784-64993806 GTTGTTTACCACTTACTGAATGG + Intronic
1118974098 14:70662586-70662608 AATGTTTGCCACTTAATAGAAGG - Intronic
1122396631 14:101437524-101437546 ATTGGTTACCACTGAATGCACGG + Intergenic
1128434524 15:67632784-67632806 TTTGGTTTCAACTTACTAAAAGG - Intronic
1131747484 15:95464576-95464598 ATTGATTTTCACTTAATAACTGG - Intergenic
1134740259 16:16536699-16536721 AAAAGTAACCACTTAATAAATGG + Intergenic
1134824943 16:17276933-17276955 AATAGTTAGCAGTTAATAAAAGG + Intronic
1134927241 16:18175462-18175484 AAAAGTAACCACTTAATAAATGG - Intergenic
1138943111 16:61814055-61814077 TAGGGTTACCAGTTAATAAAAGG - Intronic
1139055655 16:63180590-63180612 ATCGTTTACCAGATAATAAAAGG - Intergenic
1140918083 16:79511663-79511685 ATTGGTGAGCACTCAATAAATGG - Intergenic
1148844428 17:50520836-50520858 ATTGTTAAGCACTCAATAAAAGG + Intronic
1149076701 17:52604054-52604076 TTTCCTTACCACTTACTAAATGG - Intergenic
1149972505 17:61233108-61233130 CTTTGTTACCACTTAAAAAGGGG + Intronic
1150264365 17:63822536-63822558 GTTTGTTTCCACTGAATAAAAGG + Intronic
1156069208 18:33185711-33185733 ATTTGGTACCACTTAATTTAAGG + Intronic
1159304579 18:66624102-66624124 ATTATTTACCAATAAATAAAAGG + Intergenic
1159459644 18:68707738-68707760 AATGCTTACAACATAATAAAGGG - Intronic
1164907955 19:31982957-31982979 GTTGGTTACTAGTTTATAAATGG - Intergenic
1165290403 19:34879535-34879557 ATTGGGTATCACTTAATACCTGG - Intergenic
929439175 2:41952048-41952070 CTTGGTAAGCACTCAATAAATGG + Intronic
936666058 2:114597052-114597074 AGTGTTTACCACTTAACTAAAGG + Intronic
936715019 2:115176561-115176583 ATTGGCCTCCACTTAATAACAGG - Intronic
936981034 2:118265563-118265585 AGTGGATATCACTCAATAAATGG + Intergenic
940459036 2:153939019-153939041 ATAGCTTACCATTTAAGAAAGGG + Intronic
941514363 2:166454489-166454511 ACTGGTCATGACTTAATAAAAGG + Intronic
943585123 2:189729835-189729857 ATGGGTTAACCCTAAATAAATGG - Intronic
947821244 2:233072142-233072164 CCTAGTTACCACTTGATAAAAGG + Intronic
1170034677 20:11977835-11977857 AGTGGTTACCACTTGGGAAAGGG - Intergenic
1170215620 20:13888163-13888185 ATTAGTTAACCCCTAATAAATGG - Intronic
1173017648 20:39240130-39240152 ATTGTTTTCCACTGAAGAAAGGG + Intergenic
1174416497 20:50370750-50370772 ATTGATTATGCCTTAATAAATGG - Intergenic
1178102778 21:29287835-29287857 ATTTGTAATCATTTAATAAAAGG - Intronic
1178815535 21:35925736-35925758 AATGGTTAGTAATTAATAAAAGG - Intronic
951495280 3:23318321-23318343 ATTGGCTTCCATTTAATGAAAGG - Intronic
952431199 3:33224886-33224908 ATGGGTTACCACATAGTAAATGG + Intergenic
952951744 3:38531269-38531291 TTTGGTAAGCTCTTAATAAATGG + Intronic
953039319 3:39240831-39240853 ATTGGTTGCCAGTTAATATCAGG + Intergenic
955328674 3:58029144-58029166 GTTAGTTACCACTACATAAAGGG - Intronic
956994200 3:74805555-74805577 ATTGGTTGCTAGTTAGTAAATGG - Intergenic
958664475 3:97117614-97117636 ATTGATTACCTGTTAATGAATGG + Intronic
959844458 3:111017423-111017445 ATAGATTACCATTTAACAAATGG + Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
960727998 3:120690930-120690952 ATTTGTCACCACTTACTATAGGG - Intronic
962424890 3:135261157-135261179 ATTGGTAAGCAATTAATAAAGGG - Intergenic
963501399 3:146131672-146131694 ATTGGTTACCACTTAACTGCAGG - Intronic
964864675 3:161243488-161243510 ATTGGAGACCACTCATTAAATGG + Intronic
965502680 3:169475106-169475128 ATTTGTTACCAATAAATACATGG - Intronic
966521580 3:180879556-180879578 ATTTGAAACCACATAATAAATGG - Intronic
967588188 3:191239717-191239739 ATTGGTTACCACTTAATAAATGG - Intronic
967728735 3:192886664-192886686 ATTGTTTAACATTCAATAAATGG + Intronic
969263707 4:6050420-6050442 TTTGGTGACCCTTTAATAAATGG + Intronic
971715534 4:30170865-30170887 ATTATTAACCACTTAATATAAGG - Intergenic
973258676 4:48138746-48138768 CATGGTTACCACTTCATAATTGG + Exonic
975146253 4:70970652-70970674 TTTAGGTACCACTAAATAAATGG - Intronic
976642786 4:87356566-87356588 AGTGGTTTCCACTCAATAGAGGG + Intronic
977243431 4:94601785-94601807 ATTGAAAACCAATTAATAAATGG + Intronic
978435902 4:108684286-108684308 ATTGGTTATTATTTTATAAAAGG + Intergenic
978631766 4:110755623-110755645 ATTTGTTACAACAAAATAAATGG - Intergenic
978641848 4:110880020-110880042 ATTGATTCCCAAATAATAAATGG - Intergenic
979314792 4:119249471-119249493 AATGGTTACAACTTAATTATAGG - Intronic
980669089 4:135980529-135980551 AATGGTTACTAGTGAATAAATGG - Intergenic
980789879 4:137606391-137606413 AATGGTTATCATTTTATAAAAGG + Intergenic
981637938 4:146901740-146901762 AATGGTTATCACTTTATATAAGG - Intronic
982529602 4:156522524-156522546 AGAGGTTAACACTTCATAAATGG + Intergenic
984646046 4:182220800-182220822 ATTAATTACCAGTTATTAAAGGG - Intronic
987625546 5:20395365-20395387 GTTAGTTCCCACTTAATAAGTGG - Intronic
987877899 5:23704113-23704135 ACTAGCTATCACTTAATAAAGGG + Intergenic
988280500 5:29139911-29139933 ATTGCTTACCATTTTTTAAATGG + Intergenic
988427660 5:31082167-31082189 ATTTGTTACCATTTTTTAAATGG + Intergenic
989195069 5:38708501-38708523 ATTTGGAACCACTTAACAAAAGG + Intergenic
989317648 5:40101619-40101641 ATTTATTAACAGTTAATAAAGGG - Intergenic
990257956 5:53991065-53991087 ATTGGCTTCCACTTCAAAAATGG - Intronic
990919232 5:60944759-60944781 AGTTGTTACCAGTAAATAAAAGG + Intronic
992555521 5:77899117-77899139 AGTTTTTACCACTAAATAAATGG - Intergenic
993461907 5:88192422-88192444 AATGTTTACCACTTTAAAAAAGG + Intronic
993687472 5:90957317-90957339 AATAGTTACCATTTAATGAATGG - Intronic
998154870 5:139779599-139779621 ATTTGTTAAAACTCAATAAATGG - Intergenic
999330121 5:150667952-150667974 ATTTGATACCATTTAATAAGCGG + Intronic
1001062998 5:168510066-168510088 CTTGGTTACCACTGAACAAGAGG + Intronic
1003630795 6:7784974-7784996 ATTGGTTACCCCTTGCCAAATGG - Intronic
1004856797 6:19759149-19759171 AGTGGTAAGTACTTAATAAATGG - Intergenic
1004953291 6:20699175-20699197 ATGGTTTATCCCTTAATAAATGG + Intronic
1007144840 6:39618076-39618098 ATTGATTACAACTTTCTAAAAGG + Intronic
1008854985 6:56073181-56073203 ATTGTGCACCACTTAATAAGGGG + Intronic
1009988648 6:70813285-70813307 ATTACCTACCAGTTAATAAATGG + Intronic
1012623713 6:101380100-101380122 ATTGGATACCACTTAAGAGAAGG - Intergenic
1013372424 6:109482795-109482817 ATTGGTTCCCACATACGAAATGG - Intronic
1013595228 6:111654752-111654774 ATTGGTGGCCACTAAATAGAGGG - Intergenic
1014488424 6:122030772-122030794 TTTGATTTCCAATTAATAAATGG + Intergenic
1014649276 6:124016105-124016127 ATTACTTACCATTTTATAAATGG + Intronic
1015988246 6:138908181-138908203 ATTGAATTCAACTTAATAAAGGG + Intronic
1016608064 6:145957138-145957160 ATTGGTATCCATTTACTAAAAGG - Intronic
1018548741 6:164967621-164967643 ATTAATTAGCACTTAATAACAGG + Intergenic
1022048233 7:26640429-26640451 ATTGTTTTCCACTTTAAAAAAGG + Intronic
1025254139 7:57372005-57372027 ATTGATTATACCTTAATAAATGG + Intergenic
1027671264 7:81103037-81103059 CTTGGTTAGTATTTAATAAATGG - Intergenic
1028123864 7:87088772-87088794 ATTGGTTAGATCTTAATTAATGG + Intergenic
1031305815 7:120125387-120125409 AATGGTTAAGACTTAGTAAAAGG + Intergenic
1031691229 7:124790333-124790355 ATTTGTTAACTTTTAATAAAAGG + Intronic
1034606694 7:152322982-152323004 ATTGGCTAACACCTAACAAATGG + Intronic
1037437790 8:18881899-18881921 ATAGGATACCAATTAATAGAAGG + Intronic
1040898287 8:52390930-52390952 ATTGGTTTCCAATCAATAAATGG + Intronic
1045653851 8:104367298-104367320 ATTGTAAACCACTTAAGAAAAGG + Intronic
1045796199 8:106047868-106047890 ATTGGTGACCAGTTTATAACTGG + Intergenic
1046587778 8:116168625-116168647 ACTGCTTACCACTTAATTAACGG - Intergenic
1047331351 8:123890751-123890773 ATTAGTTATCAATTAATAAATGG - Intronic
1050498888 9:6273175-6273197 TTTGGTTTCCAATAAATAAAGGG - Intergenic
1053599152 9:39592523-39592545 CTTGATTAGCACGTAATAAAAGG - Intergenic
1053856904 9:42347024-42347046 CTTGATTAGCACGTAATAAAAGG - Intergenic
1054568392 9:66783731-66783753 CTTGATTAGCACGTAATAAAAGG + Intergenic
1058445003 9:105047003-105047025 AGTGGATACCAATTAATGAATGG - Intergenic
1059724025 9:116988425-116988447 CTTGGTTATCACTTAGAAAAAGG + Intronic
1060443815 9:123669066-123669088 AATGCTTACCATTCAATAAATGG + Intronic
1186887540 X:13929606-13929628 ATTGATTACCACTACTTAAAGGG - Intronic
1188080046 X:25828005-25828027 CTTGATTACCACTTAAGACAAGG - Intergenic
1191609671 X:63099210-63099232 TTTGTTTACCAATGAATAAATGG + Intergenic
1192720786 X:73695544-73695566 ATTGTTCCCCATTTAATAAATGG + Intergenic
1193375767 X:80758817-80758839 ATGGATTACCATGTAATAAAGGG - Intronic
1194160635 X:90447247-90447269 AGTGCTTAGCACTTAGTAAATGG - Intergenic
1197012460 X:121582933-121582955 GTTTGGTACCACTTAACAAATGG - Intergenic
1197155210 X:123262987-123263009 ATTGCTTTCCATTTAGTAAAAGG - Intronic
1199389247 X:147260949-147260971 ATTATTTACTACTTAATTAATGG - Intergenic
1199937626 X:152591056-152591078 AGTGGTCACAACTTGATAAATGG + Intergenic
1199937854 X:152594571-152594593 ATTGGTTACAACTTGATAAAGGG - Intergenic
1200506926 Y:4024179-4024201 AGTGCTTAGCACTTAGTAAATGG - Intergenic
1200681245 Y:6213779-6213801 ATTGTTTACCACTTAAGCTAAGG - Intergenic
1201672390 Y:16538501-16538523 CTTCTTTACCAATTAATAAAAGG - Intergenic