ID: 967596656

View in Genome Browser
Species Human (GRCh38)
Location 3:191332783-191332805
Sequence CTTGGAGAGCAAAAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 393}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967596656 Original CRISPR CTTGGAGAGCAAAAGGAAGT AGG (reversed) Intronic
900983493 1:6059803-6059825 CCTGGTGAGCAAGAGGAAGGAGG + Intronic
901373952 1:8824123-8824145 CTTTGAGAGCCAAAGGCAGGAGG + Intergenic
901412959 1:9097804-9097826 CTTGGAGGTCAGAAGGAAGATGG - Intergenic
901617930 1:10556511-10556533 CTTGGAGGGCCAGAGGCAGTCGG + Intronic
902318657 1:15643647-15643669 CTAGGTGAGCAAAAGGCACTGGG + Exonic
902755526 1:18546911-18546933 CTTGGAGAGCAGAAACAATTTGG + Intergenic
905684337 1:39898191-39898213 CTTGCTGTGCAAAAGGAAATTGG - Intronic
906739103 1:48163655-48163677 CTTGGATAGCAGTAGTAAGTTGG + Intergenic
908222786 1:62024948-62024970 CTTCCAGAGGACAAGGAAGTAGG - Intronic
909175923 1:72358507-72358529 CTTGCAGACCAGAAGGGAGTGGG + Intergenic
909516940 1:76521352-76521374 CATGGAGAGGAAAAGAAGGTGGG + Intronic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
913042699 1:115042754-115042776 CTTACAGGCCAAAAGGAAGTGGG + Intergenic
915050241 1:153062558-153062580 CTTGGAGATCAGGAGGCAGTAGG - Intergenic
915051360 1:153077169-153077191 CTTGGAGATCAGGAGGTAGTGGG + Intergenic
915051658 1:153081368-153081390 CTTGGAGATCAAGAGGTAGTGGG + Intergenic
915054867 1:153118534-153118556 CTTGGAGATCAGGAGGCAGTGGG + Intergenic
917176441 1:172240852-172240874 CTTGGAGCACAAAAAGAAATAGG + Intronic
917671741 1:177280016-177280038 CTTGAAGAGGGAATGGAAGTTGG + Intronic
918233737 1:182558861-182558883 CTTACATAGCAAAAGGAATTTGG - Intronic
918239735 1:182611033-182611055 CTAGGAGAGGAAGAGGAAGGAGG - Intergenic
918321151 1:183365961-183365983 GATGGAGAGGGAAAGGAAGTTGG - Intronic
919079097 1:192848449-192848471 CTGGGGGAGCAAGAGGAAGCTGG + Intergenic
919832483 1:201551994-201552016 CATGGCCAGCAAGAGGAAGTGGG - Intergenic
919907156 1:202085904-202085926 CTTAGAGAGCATTTGGAAGTAGG + Intergenic
920013968 1:202890700-202890722 CTTCCAGAGCAAAAGGAAGGAGG - Intergenic
920609561 1:207423683-207423705 CTTGGGGAGCAGAAGGCGGTCGG - Intergenic
920664585 1:207953147-207953169 CTTAGAGAGCAAAAGAAAAAAGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1062815197 10:494210-494232 CTTTGACAGCAGAAAGAAGTGGG + Intronic
1063306475 10:4907159-4907181 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1063671234 10:8101864-8101886 CCTGGAGAGGAGAAGGCAGTCGG - Intergenic
1063794780 10:9501149-9501171 CTTGGAGAGAAACAGAAAATAGG - Intergenic
1064769848 10:18712046-18712068 CTTGGAGGGGAGAAGGAAGGAGG - Intergenic
1065156296 10:22873398-22873420 CTTGGTGATCAAATGGAAATTGG - Intergenic
1065281574 10:24144319-24144341 CTTGTAGAGCAAAGGGCAGAGGG + Intronic
1066484865 10:35833548-35833570 GGAGGAGAGCAAAAGGAAATAGG + Intergenic
1066668746 10:37814707-37814729 CTTGGAGGCCAGAAGGCAGTGGG - Intronic
1066723081 10:38359870-38359892 CTTGGACAGTAAAATGAAATGGG + Intergenic
1067004080 10:42644825-42644847 CTGGGAGAGCTAAAAGAAGCTGG + Intergenic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1067663411 10:48253435-48253457 CATGGAGACCAAAAGGCAGTTGG + Intronic
1069047091 10:63754117-63754139 TTTGCAGAGCAAAAGCAAGCAGG + Intergenic
1069728402 10:70595817-70595839 CCTGGAGGGCAAACGGAAGGAGG + Intergenic
1070206551 10:74268960-74268982 TTTGAAGAATAAAAGGAAGTTGG + Intronic
1070939530 10:80331460-80331482 CTTGGAGGACAGAAGGCAGTGGG + Intergenic
1071086402 10:81873192-81873214 ATTGGAAAGCTAAAGGAATTTGG + Intergenic
1072872213 10:99132584-99132606 CATGGAGAGCAAGACGAAGGAGG + Intronic
1073896818 10:108170775-108170797 CTTGGAGATGGAAAGGAAGTGGG - Intergenic
1074783312 10:116817984-116818006 CCTGGAGAGGAAGAGGAAGCTGG - Intergenic
1075291254 10:121232994-121233016 GTTGGAGAGCTTAAGAAAGTAGG + Intergenic
1075804269 10:125174135-125174157 GTGGGACAGCAAAAGGAAATTGG - Intergenic
1076605606 10:131687318-131687340 ATTGGAAAACAAAATGAAGTAGG + Intergenic
1077960381 11:7070902-7070924 CTTGGATAGCAAAAGGCTCTTGG + Intronic
1078433576 11:11306315-11306337 CTTGGTGATCAGAAGGATGTAGG + Intronic
1080235355 11:30062320-30062342 CATGGAGGCCAGAAGGAAGTGGG + Intergenic
1080555232 11:33410138-33410160 TTTGGAGAAGAAAAGCAAGTGGG + Intergenic
1080895835 11:36448273-36448295 CATGGAGAGCAAATGGGGGTGGG - Intronic
1081682699 11:45019371-45019393 CTGGGAGAGGAAAGGGCAGTCGG + Intergenic
1083138924 11:60705429-60705451 CCTGCAGAGCAAAAGGAGGAAGG - Intronic
1085768862 11:79307655-79307677 AATGGCGAGCAAAAGGAAATGGG - Intronic
1087184652 11:95175935-95175957 CATGGAGAGGAAATGGAACTTGG + Intronic
1089821409 11:121230580-121230602 CTTGGAGGGCACAAGGGAATTGG + Intergenic
1090184259 11:124725924-124725946 CTTGCAGAGCAAGGGGAAATGGG - Intergenic
1090686874 11:129131520-129131542 CTTGGAGAGCCAGAGAATGTGGG + Intronic
1090686952 11:129132150-129132172 CTTGGAGAGCCAGAGAATGTGGG + Intronic
1091249653 11:134132245-134132267 CTTGGAGGCCAGAAGGAAGTGGG + Intronic
1091813468 12:3418819-3418841 CTTGAAGAGGAAAAGGATGAGGG + Intronic
1093064390 12:14641277-14641299 ATTAGAGAGCAAAAGCAGGTTGG - Intronic
1093434651 12:19122625-19122647 CATGGAGAATAAAAGGAAGAAGG - Intergenic
1094402308 12:30075215-30075237 CATGGACAGCAAAAGGGAGGTGG - Intergenic
1094459120 12:30674508-30674530 CTTTGAGATCATAATGAAGTGGG - Intronic
1094726064 12:33117555-33117577 CTTGTAGAGGGAAAGGAAGAGGG + Intergenic
1095141622 12:38670231-38670253 TTTGGATAGGAAAAGGAAGAAGG - Intronic
1095421533 12:42029072-42029094 TTGGGAGAGCAAAAGGAAAAAGG - Intergenic
1095575975 12:43739726-43739748 CTTGAAGAACAAAAGGATGCTGG + Intronic
1096694040 12:53337624-53337646 CTGGGAGAGCAAAAGGAGCAAGG - Intronic
1098056832 12:66516016-66516038 CTTGGAGTACAAAAGTAAGAAGG + Intronic
1098372283 12:69773115-69773137 CTTGCAGATCAGGAGGAAGTAGG - Intronic
1098821096 12:75230967-75230989 CTTGCAGACCAAGAAGAAGTAGG - Intergenic
1099234036 12:80060951-80060973 CTTGGAAAGCAAAATGAATGCGG + Intergenic
1099682502 12:85845545-85845567 CTTTGAGAGCAATAGAAAGCAGG + Intergenic
1099810928 12:87581124-87581146 CTTGGAGAGATAAAGAAACTTGG + Intergenic
1099986028 12:89665409-89665431 CTGGGAGAGCAAAAGAAAGTAGG - Intronic
1100005701 12:89892487-89892509 CATGGAGAGGATAAGAAAGTTGG + Intergenic
1100805952 12:98283766-98283788 CTTCCAGAGCAAAGAGAAGTAGG - Intergenic
1101762589 12:107671059-107671081 CTTGGGGAGCAAAAGTACGAGGG + Intergenic
1102131959 12:110538619-110538641 CTTGGAGAGCAAACTGGGGTTGG - Intronic
1102299656 12:111761894-111761916 GTTGGAGAGCAAGTGGAACTAGG + Intronic
1102520960 12:113477163-113477185 TTTGGAGAGCTGCAGGAAGTGGG + Intergenic
1103456755 12:121073864-121073886 CATGGAGGCCAAAAGGCAGTGGG + Intergenic
1103507911 12:121453942-121453964 CTTGGGGAGCAGACGGAGGTGGG - Intronic
1103871789 12:124097518-124097540 TTTGCAGAGCAAAAAGAAATAGG - Intronic
1104189456 12:126465362-126465384 CTTGCAGAGAAAAAGAAATTAGG + Intergenic
1104276828 12:127336728-127336750 CAGGGAGAGCAACAGGAAGGTGG + Intergenic
1104823253 12:131690777-131690799 CTGGGAGAGTAAAAGGCCGTTGG + Intergenic
1105365197 13:19757843-19757865 ATTGGAGAGGAAAGGGAGGTGGG + Intronic
1105766332 13:23563425-23563447 GTTGGAGAGCAGAAGGCAGCTGG + Intergenic
1106195431 13:27490244-27490266 TTTAGAGCACAAAAGGAAGTGGG - Intergenic
1106458656 13:29949092-29949114 TTTTGAGAGCTAAGGGAAGTCGG + Intergenic
1106544058 13:30715197-30715219 CTTGGAGAGCCCCAGGAACTTGG - Intronic
1106600119 13:31180440-31180462 TCTGGAGAGCAACAGAAAGTTGG - Intergenic
1107221914 13:37992347-37992369 TATGGAAAGAAAAAGGAAGTGGG - Intergenic
1107864812 13:44693334-44693356 CTAGGAGAGGAAAAGGCAGTGGG - Intergenic
1108342646 13:49513269-49513291 CTTGGAGAGCTGGAAGAAGTAGG + Intronic
1109485806 13:63017216-63017238 CATGGAGAGCAGAAGGAATTAGG + Intergenic
1110948747 13:81458154-81458176 CTTTGAGAGGAAAAGAAATTAGG + Intergenic
1111572800 13:90108606-90108628 TCCGGAGAGCATAAGGAAGTTGG + Intergenic
1111930744 13:94510758-94510780 CTTGGAGCTCAAAAAGAAGTAGG - Intergenic
1116180908 14:41533334-41533356 TTTGGAGACCACAAGGCAGTGGG - Intergenic
1116428571 14:44820161-44820183 CATGGAGAGCAAAGAAAAGTAGG + Intergenic
1119056491 14:71427355-71427377 TTTGGAGGCCAAAAGGCAGTAGG - Intronic
1119103308 14:71900393-71900415 CTGGGAGACCAAAAGCCAGTAGG - Intergenic
1119184730 14:72632042-72632064 CTTGATGAGCAAAAGGAAAGGGG + Intronic
1119189641 14:72671907-72671929 CACTGAAAGCAAAAGGAAGTTGG + Intronic
1120034712 14:79683379-79683401 CTTGGATAGCAATAGCAAATTGG + Intronic
1122253130 14:100454549-100454571 ATTGGAGAGCAAAAAAAAGCAGG + Intronic
1122304238 14:100751609-100751631 CTCGGAGAACAGAAGGCAGTGGG - Intergenic
1122869494 14:104630186-104630208 TTTGGAAAGAAAAAGGAAGAAGG + Intergenic
1122987487 14:105219233-105219255 CTGGGCGAGCACAGGGAAGTGGG + Intronic
1123953531 15:25309917-25309939 CTTGGAAGGCAGAAGAAAGTGGG - Intergenic
1129324926 15:74794816-74794838 CATGGAGAGCAGAAGGAGCTGGG - Intronic
1129464377 15:75715773-75715795 GTTGGAGGGCAGAAGGAAGAAGG - Intergenic
1129679562 15:77650591-77650613 CTTGCAGAACAGGAGGAAGTGGG - Intronic
1129720868 15:77877239-77877261 GTTGGAGGGCAGAAGGAAGAAGG + Intergenic
1130191540 15:81741016-81741038 CTTGGAGACTAAAGGGGAGTAGG + Intergenic
1131195857 15:90354263-90354285 CTTGCTGAGGAAAATGAAGTTGG + Intronic
1131653250 15:94425348-94425370 CTTGAAGAAGAAAAGGAAATTGG - Intronic
1133120565 16:3604244-3604266 CATGGAAAACAAAAGGAAATGGG + Intronic
1134432568 16:14224653-14224675 CTTGAAGACCAGAAGGCAGTGGG + Intronic
1136749866 16:32624995-32625017 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1137973462 16:53009260-53009282 ATTGGAAACCAAAAGGGAGTAGG - Intergenic
1138429614 16:56960553-56960575 CCTGGAGAGAAAAGGGAGGTGGG - Intergenic
1138488967 16:57365043-57365065 CTTTGGGAGCACAAGGAAGGTGG - Exonic
1138963397 16:62054204-62054226 ATTGGTTAGTAAAAGGAAGTTGG - Intergenic
1140557962 16:75943365-75943387 CTTGGTGAAAAGAAGGAAGTGGG + Intergenic
1140921482 16:79542526-79542548 CTTGGATAACAAAAGGAAGCAGG + Intergenic
1141989841 16:87603368-87603390 CCTGGAGAGCAAGGGGAAGTGGG + Exonic
1203052000 16_KI270728v1_random:884193-884215 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1145066345 17:19763957-19763979 CTTGGAGATCAATAGGATGTGGG - Intergenic
1147268874 17:39252902-39252924 CTTGGAGAGCTAATGGAACCTGG + Intergenic
1147747276 17:42702523-42702545 CTGGGAGGGCTAAAGGACGTCGG + Exonic
1148142484 17:45338503-45338525 CTTGGAGAAAAACAGGAAGCTGG + Intergenic
1148464799 17:47858301-47858323 CTTGGAAAGCAGAAAGCAGTTGG - Intergenic
1148638794 17:49169491-49169513 GAGGGAGAGCAGAAGGAAGTGGG - Intronic
1149373069 17:56014908-56014930 CTTGCAGAGGAAAAGGAAGAAGG - Intergenic
1150436917 17:65161163-65161185 TTGGGATGGCAAAAGGAAGTGGG - Intronic
1154248997 18:12727041-12727063 CTGGGAGAGAAAATGCAAGTTGG - Intergenic
1154265561 18:12875759-12875781 TTTGGAGACCAAAGGGAAGAAGG + Intronic
1155372231 18:25113675-25113697 CGTGGAGAGAACGAGGAAGTGGG + Intronic
1155786986 18:29913942-29913964 CCTGTAGAGGAAAAGGAACTTGG - Intergenic
1156482125 18:37442969-37442991 TTTTGAAAGCAAAAGGTAGTGGG - Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157786183 18:50485080-50485102 ATTGGAAAGTAAAAGGAAGAGGG - Intergenic
1158233090 18:55280554-55280576 CTTTGAGAGCAAAAGAAAATGGG - Intronic
1158434851 18:57428417-57428439 TGTGGGGAGCAAAAGGAAGGAGG + Intergenic
1159225746 18:65532895-65532917 CTTGGGGAGCAAAAATAAGTTGG + Intergenic
1159450126 18:68590091-68590113 GTTGGATGGCAGAAGGAAGTTGG + Intergenic
1161064103 19:2229123-2229145 CTTTGAGACCAGAAGGAAGTTGG + Intronic
1162882010 19:13666695-13666717 CTTGCAGGGCAATAGGAAGAGGG - Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1165044015 19:33090045-33090067 CTTGGAGAGAATCAGGAAGGAGG + Intronic
1167236171 19:48317000-48317022 CTTGAAAAGAAAAAGAAAGTGGG + Intronic
926910206 2:17845795-17845817 TTTGGATGGCAAAAGGAAATGGG + Intergenic
927423612 2:22957407-22957429 CTTGGGGAGCAAAATGAAGCTGG + Intergenic
928213251 2:29339596-29339618 GATGGAGAGAAAATGGAAGTGGG + Intronic
928420169 2:31132130-31132152 CTAGGAGAGTGAAAGGAAGCTGG + Intronic
928559764 2:32468212-32468234 ATAAGAGAGCAAGAGGAAGTAGG + Intronic
929910404 2:46084879-46084901 CCTGGAGAGAAAAAGAAGGTCGG - Intronic
929928597 2:46234906-46234928 CTTGGGGGTTAAAAGGAAGTTGG - Intergenic
931533536 2:63245455-63245477 CTTGGAGAGCAGAAGGGTGTTGG + Intronic
931635909 2:64340697-64340719 CTTGGACAGCAATGGGATGTGGG + Intergenic
932914108 2:75836295-75836317 AATGGAGAGCAAAACAAAGTGGG + Intergenic
933051244 2:77605324-77605346 CTTGGAGATCAGAAGCAAGATGG - Intergenic
933156029 2:78975867-78975889 CTTGGAAAAAAAAATGAAGTTGG - Intergenic
933298988 2:80521632-80521654 CTTGGAGATAAAAAGGAGCTAGG + Intronic
934234861 2:90221547-90221569 CTTACAAAGCAAAAGGAATTGGG - Intergenic
935257574 2:101325608-101325630 CATGGAGGCCAAAAGGCAGTGGG - Intergenic
935809078 2:106778504-106778526 ACTGGAGACCAAAAGGCAGTGGG - Intergenic
936608142 2:113977646-113977668 CTTGGAGAGGAAGAGGCAATGGG + Intergenic
936892380 2:117387561-117387583 CATGGAAACCAAAAGCAAGTGGG - Intergenic
937016202 2:118608311-118608333 CTTGAAGTGGAAATGGAAGTGGG + Intergenic
937877261 2:126835290-126835312 CTGGGAGAGCAAAATGAGGCAGG - Intergenic
938631720 2:133174761-133174783 CTTGTAGAGTAAAATGAACTGGG - Intronic
938844021 2:135189749-135189771 CTTGGAGGCCAGAAGGCAGTAGG + Intronic
939087161 2:137735242-137735264 CTTGCAGGCCAAAAGGTAGTGGG - Intergenic
940141017 2:150490502-150490524 GTCGGGGAGCAAAAGGAAGCAGG + Intronic
942200146 2:173562234-173562256 AATGGAGAGCAAAAAGAAGCAGG + Intergenic
942758668 2:179372290-179372312 CTGGGAAATCAAAAGGGAGTTGG + Intergenic
942993505 2:182232073-182232095 AGTGGTGAGGAAAAGGAAGTGGG + Intronic
943235951 2:185319807-185319829 CTTGAAGATCAAATGAAAGTAGG + Intergenic
944916568 2:204366838-204366860 CTTGGAGAGTTTAAGCAAGTTGG - Intergenic
944928623 2:204492413-204492435 CTTGGAGAGAAAAGTGCAGTTGG - Intergenic
945213840 2:207412544-207412566 CTTGGGGAGCAAAGGGCAGCTGG + Intergenic
945338997 2:208629006-208629028 CTTGAAGAGCAAAACAAAGTGGG - Intronic
945956979 2:216095432-216095454 CATGCAGAGTATAAGGAAGTTGG - Intronic
946437626 2:219668415-219668437 ATGGAAGAGCAAAAGGAAGCCGG - Intergenic
946527273 2:220534510-220534532 CTTGGAGATCAGAAGCAAGATGG - Intergenic
947181219 2:227413171-227413193 CTTGGAGAGCAAGTGAAAGAGGG + Intergenic
948588771 2:239036659-239036681 CTTGGAGTGCAAAGGCAAGAGGG - Intergenic
1169003336 20:2184556-2184578 CTGTGAGAGCCAAAGGAAATGGG - Intergenic
1170901134 20:20464532-20464554 CTTGCAGACAAGAAGGAAGTGGG - Intronic
1171127449 20:22614931-22614953 CCTGGACAGAAAAAGGACGTTGG + Intergenic
1172184274 20:33021554-33021576 CTCAGAGAGAAAAAGGAACTTGG - Intronic
1173184765 20:40832080-40832102 CTTGGAGAGCAGACAGAAATGGG + Intergenic
1173710323 20:45149926-45149948 ATTGGAGAGAAAAAGGCTGTGGG + Intergenic
1173749008 20:45461581-45461603 CTAGGAGAGGAAAAGGGAGCTGG + Intergenic
1174373496 20:50110325-50110347 ATTGCAGAACCAAAGGAAGTGGG + Intronic
1174536956 20:51258623-51258645 CTTGGAGATCCCAAGGATGTGGG + Intergenic
1174611760 20:51802778-51802800 CTTGGAGAGGAAAAGAAAATGGG + Intergenic
1175547170 20:59785873-59785895 GTTGGAAAACAAAATGAAGTAGG - Intronic
1176895080 21:14367756-14367778 AATGGAGGGCAAAAGGAACTAGG + Intergenic
1177172764 21:17671967-17671989 CTGGGAGAGCATGAGCAAGTGGG - Intergenic
1177301630 21:19252977-19252999 CTAGGATAGCAAAAGGTAGGAGG - Intergenic
1177636913 21:23799165-23799187 ATCTGAGAGCAAAAGGAAGAGGG + Intergenic
1179085977 21:38218144-38218166 CTTTGAGAGGACAAGGAAGGAGG + Intronic
1179366654 21:40765164-40765186 TTTGGAGAGGCAGAGGAAGTAGG + Intronic
1181537470 22:23554002-23554024 CTTGGAAGGGAAAAGGAAGGTGG - Intergenic
1181973907 22:26714643-26714665 CTTGGGGAGGAAGAGGAAGAGGG - Intergenic
1182836910 22:33349642-33349664 ATTGGAAAGGAAAAGGAAGGGGG - Intronic
1183874189 22:40764929-40764951 CTTTGAGAGCATGAGGAAGTGGG - Intergenic
1184561996 22:45268823-45268845 CTTTGAGAGGAAAAGGAGCTCGG + Intergenic
1185168861 22:49279739-49279761 CATGGAGAGCAGAAGGCAATGGG - Intergenic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
949727293 3:7063950-7063972 CGTGTAGAGCAAAAGGTGGTGGG + Intronic
949812821 3:8025276-8025298 CATGGAGAACAAAACGCAGTAGG - Intergenic
950706827 3:14788064-14788086 CTTGGAAAGCAGAAGGAACTAGG - Intergenic
951912309 3:27763966-27763988 CTTGAAGAGAAAAAACAAGTGGG - Intergenic
952187157 3:30982521-30982543 CATGGAGAGAAAAAGGCACTGGG + Intergenic
952481131 3:33762645-33762667 CATGCAGGCCAAAAGGAAGTGGG - Intergenic
952489381 3:33851796-33851818 CTGGGAGAGGAAAAGGAAAGAGG - Intronic
953670105 3:44955279-44955301 CTTGAAAAGAAAAGGGAAGTGGG - Intronic
953962505 3:47277940-47277962 TTAGGAGAGCAAGAGGAGGTAGG - Intronic
954103433 3:48395938-48395960 CTTGGAGAGGAGATGGGAGTGGG - Intronic
954574371 3:51667464-51667486 CTGAGAAATCAAAAGGAAGTGGG - Exonic
955117788 3:56023192-56023214 CATGGAGACCAAATGGAAGGAGG - Intronic
955818860 3:62875067-62875089 CTTGGAGTGCAAAAGGTGGGGGG + Exonic
955932723 3:64073891-64073913 AGTGGAGAGAGAAAGGAAGTAGG + Intergenic
956567597 3:70656346-70656368 CTAGGGGAGGAAAAGGAATTAGG + Intergenic
956909378 3:73801646-73801668 CTTTGAAAGGAAAAGGAATTTGG - Intergenic
957477310 3:80741146-80741168 CTTTGACATCAAAAGGAAGAGGG + Intergenic
957540816 3:81566661-81566683 ATTTGAGAGCAAAAGGAGGAAGG - Intronic
957933207 3:86909773-86909795 CTTGGAGACCAAAAAGGAATTGG - Intergenic
958132447 3:89445646-89445668 GTGGGAAAGCATAAGGAAGTGGG - Intronic
959346584 3:105202646-105202668 ATTGGAGGCCAGAAGGAAGTGGG - Intergenic
959578703 3:107962413-107962435 CTTGAAGATCAAAAGGATGCAGG - Intergenic
959620411 3:108393575-108393597 CTTGAAGAGCAAAATCAGGTTGG - Intronic
960842598 3:121975406-121975428 CTTGGAGATCAGAAGCAAGATGG + Intergenic
962625302 3:137220117-137220139 CCTGGAGAGCAACAGCTAGTAGG + Intergenic
963744836 3:149115618-149115640 TTGGGAGAGCAAATGGAGGTGGG - Intergenic
963932843 3:151022149-151022171 CTGGGAGACCTAGAGGAAGTTGG - Intergenic
964521081 3:157568095-157568117 CTTGCAGGCCAGAAGGAAGTGGG - Intronic
964673447 3:159251980-159252002 ATAGGAGAACAAAAGGAAATAGG - Intronic
965682601 3:171266838-171266860 TTTGGAGAACAGAAGGAAGCCGG - Intronic
966387912 3:179421202-179421224 CTGTGAGAGAAAAAGGAATTAGG - Intronic
966499559 3:180624240-180624262 CATGGAAACCAAAAGCAAGTAGG - Intronic
966535233 3:181025373-181025395 CTTGGAGGCCAGAAGGGAGTGGG - Intergenic
967596656 3:191332783-191332805 CTTGGAGAGCAAAAGGAAGTAGG - Intronic
969122849 4:4922578-4922600 GGTGAAGAGGAAAAGGAAGTGGG + Intergenic
969501769 4:7557796-7557818 CTTGGGGAGGAAATGGAAGTGGG + Intronic
969574280 4:8027508-8027530 CTTGGAAAGCTACAGGAAGAGGG - Intronic
969847818 4:9933412-9933434 CTGGGAGAGCAAAAGGAGTTGGG - Intronic
970322797 4:14892078-14892100 CCAGTAGAGTAAAAGGAAGTAGG - Intergenic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
971636793 4:29071477-29071499 CTTGAAGGCCAAAAGGGAGTGGG - Intergenic
972176528 4:36414013-36414035 CTTGGATAGCAAAATGGAGTAGG + Intergenic
972682142 4:41316312-41316334 CTTGGAGATCAGAAGCAAGATGG + Intergenic
973273777 4:48287864-48287886 CTTGGGGAGAAAAAGGAACAGGG - Intergenic
973661893 4:53116609-53116631 CTTGCAGAGGTAAAGGAAGATGG + Intronic
974078288 4:57187802-57187824 CCTGGGGAGCAAGAGGAGGTGGG - Intergenic
974557427 4:63469090-63469112 CTTAGAGTGCAAAAGCAACTTGG - Intergenic
975058559 4:69967589-69967611 CTGGTATAGCAAAAGGAAATAGG + Intergenic
975911714 4:79274916-79274938 CTTGGAAAGCAAAAGAAAAAAGG - Intronic
976535588 4:86211399-86211421 TTTGGAGGGCAGAAGGGAGTGGG + Intronic
979726548 4:123969389-123969411 CTAGGAGAGCCTTAGGAAGTGGG + Intergenic
981013808 4:139952698-139952720 CTTCTAGAGCAAGAGGAGGTGGG - Intronic
984624072 4:181986259-181986281 CTTCAAGAGAAAAAGGAAGGAGG - Intergenic
984832777 4:183991151-183991173 TTTGGAGAGAAAAAGGCACTAGG - Intronic
985162795 4:187061863-187061885 CATGGAGAACTGAAGGAAGTGGG - Intergenic
987700930 5:21397279-21397301 CTTGAAGAGGAAAACGAAGAAGG + Intergenic
988489533 5:31694617-31694639 CTTGGAGAGGAAATGGGACTGGG + Intronic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
990746873 5:58967551-58967573 ATTGGAGAGCAAAAGAAGGAAGG + Intergenic
992892187 5:81213627-81213649 CTTGGAGGGCAAAATGAAGATGG - Intronic
993072415 5:83181951-83181973 CTGGGAGAGCCAAAACAAGTAGG + Intronic
993628687 5:90257593-90257615 CTTGGAGAACAAAGGGAAAGGGG + Intergenic
993690570 5:90995350-90995372 TTTGGGGAGCAAAATGAAGCTGG - Intronic
994122560 5:96133359-96133381 TTTTGAGAGAAAAAGGATGTGGG + Intergenic
994630066 5:102274475-102274497 CTTGGAGAGCAGCAGGCTGTGGG - Intronic
995105466 5:108372591-108372613 CATGGAGACCAGAAGGCAGTGGG + Intronic
995425333 5:112015055-112015077 TCTGGAGAGCAGAAGGAGGTTGG + Intergenic
996690600 5:126336183-126336205 CTTGGAGAGCTTCAGGAAGCAGG + Intergenic
997654820 5:135546918-135546940 CTTGGTGAGAAAGAGAAAGTTGG + Intergenic
997764706 5:136489448-136489470 CATGGAGACCAGAAGGCAGTGGG - Intergenic
998424340 5:142013798-142013820 CTTGGAGAGAAAAATTAACTTGG + Intergenic
999158575 5:149476331-149476353 CCTGGAGAGGAAAAGGAATAAGG + Intergenic
999532958 5:152482620-152482642 CATATAGAGCAAAAGGAAATGGG - Intergenic
999579191 5:153015635-153015657 TTTGCAGACCAGAAGGAAGTGGG + Intergenic
1000383940 5:160655923-160655945 CTTTGAGAGCGAAGGAAAGTGGG + Intronic
1000685237 5:164240234-164240256 AATGGAGACCAAAAGGCAGTGGG + Intergenic
1001024019 5:168207825-168207847 TTTGGAGAGACAAAGGAAGGAGG - Intronic
1001711303 5:173780559-173780581 TTTGGAGAACAAAAGGAGGAAGG - Intergenic
1001771537 5:174300731-174300753 CTAGGAGTGCAAAAGGTAGAGGG - Intergenic
1002261149 5:177994918-177994940 CTGGCAGTGCAATAGGAAGTGGG - Intronic
1003360983 6:5424995-5425017 CGTGGAAAGAAAAAGGAAGGAGG - Intronic
1003575270 6:7287463-7287485 CCAGGAGAGGAAAAGGAAATGGG - Exonic
1003727176 6:8778051-8778073 TGTGGAGAGAAAATGGAAGTGGG - Intergenic
1004242424 6:13936905-13936927 TTTGGAGAGTAAAAAGAATTGGG + Intronic
1004393380 6:15227687-15227709 CTTGGGGAGGAGAAGAAAGTAGG - Intergenic
1004932954 6:20479416-20479438 TTTGGGGAGCACAAGGAAGGGGG + Intronic
1005909124 6:30292702-30292724 GTTGGAGAGAAAACTGAAGTTGG - Intergenic
1006747521 6:36354599-36354621 CTTGGAAAGAAAAACAAAGTTGG - Intergenic
1009769564 6:68127493-68127515 CATGGAGGACAGAAGGAAGTAGG - Intergenic
1009910995 6:69926938-69926960 CATGGAGACCAGAAGGCAGTGGG + Intronic
1011025182 6:82860928-82860950 CCTGAAGAGCAAAAAGAAGCTGG + Intergenic
1012637212 6:101558985-101559007 CTTGGTAACCAAAAGGAAGGTGG - Intronic
1013050191 6:106526032-106526054 CTTGGAGATACACAGGAAGTTGG + Intronic
1013072202 6:106739525-106739547 CTTGCAGAGCCAAAGGAACCTGG + Intergenic
1013260914 6:108441372-108441394 TTTGGAGAGGAAAAGGAGGGAGG - Intronic
1014214954 6:118744579-118744601 CCTGGAGAGCAGAAAGAGGTTGG - Intergenic
1014384285 6:120781311-120781333 CTTGGGGAGCACAATGAAGTAGG - Intergenic
1014431392 6:121374790-121374812 TTTGGAGAGCAAAAGGCATTGGG - Intergenic
1014762699 6:125375138-125375160 AATGGAGAGAAAAAGGAAGAAGG - Intergenic
1015257839 6:131199987-131200009 CTTGAAGAGCGACAGGAAGAGGG - Intronic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1015385469 6:132617951-132617973 CATGGAGAGGATGAGGAAGTTGG + Exonic
1015855783 6:137623073-137623095 CTTGGAAAGCACCAGGAATTTGG + Intergenic
1015987424 6:138898417-138898439 CTTGGACAGCGTTAGGAAGTAGG - Intronic
1015997153 6:139006993-139007015 CTCAGAGAGAAAAAAGAAGTAGG + Intergenic
1017450465 6:154550092-154550114 ATTGGAGAGGATAAGGAAGCAGG + Intergenic
1017975677 6:159355200-159355222 CTTGGAGATCAGAAGCAAGATGG - Intergenic
1018115168 6:160576232-160576254 CTTGAAGAGCAAAAGCAGGAAGG - Intronic
1018227345 6:161641040-161641062 CTTGGAGATGAGAAGGAAGATGG - Intronic
1019004938 6:168789133-168789155 CTTGGAGAGCAAAACGGACATGG + Intergenic
1020004685 7:4775983-4776005 CTTGGTGAGTGAAAGCAAGTGGG + Intronic
1021815490 7:24443448-24443470 CTGAGAGAGAAAAAGGAATTTGG - Intergenic
1022136148 7:27450551-27450573 CTTGGAGTGCAACAGGAATAGGG + Intergenic
1022599931 7:31748145-31748167 CTTGGAGATCAGAAGCAAGAGGG + Intergenic
1023578117 7:41651891-41651913 ACTGGAGAGCAAAATGAAGGTGG - Intergenic
1024097604 7:45996403-45996425 CATGAAGGGCAGAAGGAAGTGGG + Intergenic
1024396813 7:48879006-48879028 CTGGGTGAGTAACAGGAAGTAGG - Intergenic
1025080189 7:55975055-55975077 GTTGGAGAGCAAAAGTAGCTGGG + Intronic
1027526008 7:79269691-79269713 CTTGGAGATCACAAGCAAGATGG - Intronic
1028686329 7:93592320-93592342 CTTGGTGAGCAGGAGGAAGATGG - Intronic
1028980608 7:96963957-96963979 TTTGGAAACAAAAAGGAAGTTGG - Intergenic
1030663525 7:112248870-112248892 CCTGGAGAGAAAAAGTAAGAAGG - Intronic
1030680581 7:112429996-112430018 CATGGAGAGGATAAAGAAGTAGG - Intronic
1030761899 7:113362561-113362583 CTTGAAGATCAAGAAGAAGTTGG - Intergenic
1032116144 7:129118876-129118898 CTTGAAGGGCAGAGGGAAGTGGG - Intergenic
1032616642 7:133479762-133479784 GTCTGAAAGCAAAAGGAAGTTGG + Intronic
1032819128 7:135509088-135509110 CTTGAAAAGTAAAAGGAAGTTGG - Intronic
1032973458 7:137192848-137192870 AATGGAGAGCAAAAGGCAGTAGG + Intergenic
1033341829 7:140498106-140498128 CTTGGAGATTAGAAGCAAGTTGG + Intergenic
1033533428 7:142289123-142289145 GTTGGAGATAAAAAGGAAGTTGG + Intergenic
1033712137 7:143958781-143958803 CTTGCTGAGCAAAAGTAAGAAGG + Intergenic
1033779624 7:144653110-144653132 TTTGGAGAGCAACATAAAGTCGG - Intronic
1034628557 7:152512998-152513020 TTTGTAGATAAAAAGGAAGTAGG + Intergenic
1036097649 8:5741484-5741506 CTTGGAGAGGGAGGGGAAGTTGG + Intergenic
1036159857 8:6377268-6377290 CTTGGAGGCCAGAAGGCAGTGGG + Intergenic
1036448973 8:8848427-8848449 AGTGGAGAGGAAAATGAAGTGGG - Intronic
1036681729 8:10879138-10879160 TTTGGAGTGAAGAAGGAAGTCGG - Intergenic
1037041267 8:14237956-14237978 CTGGGAGAGAAAAAGGAAAAGGG - Intronic
1037161783 8:15781546-15781568 CTTGCAGGCCAGAAGGAAGTGGG + Intergenic
1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG + Intronic
1039337662 8:36610582-36610604 TTTACAGATCAAAAGGAAGTAGG + Intergenic
1039493534 8:37965131-37965153 CTTGGAGAGAAAAGGGAACGAGG - Intronic
1039827902 8:41190371-41190393 CTTGGAGAGCAAATTGCATTTGG - Intergenic
1041690127 8:60679536-60679558 ATTCGAGAGAAAAAGGAAGGAGG + Intronic
1043682852 8:83052552-83052574 CAGGGAGACCAACAGGAAGTAGG - Intergenic
1044015003 8:87040283-87040305 CTTGGAGATTAAAAGCAAGATGG + Intronic
1044168255 8:89016577-89016599 TTTGGGGAAAAAAAGGAAGTGGG + Intergenic
1045279589 8:100738401-100738423 TTTGGATAGCAAAAGGAGCTTGG + Intergenic
1045649830 8:104331187-104331209 CTTGGGGAGCAGAAGGACATAGG - Intronic
1045812411 8:106238225-106238247 ATTGGAGAGCTGAAGGAATTGGG + Intergenic
1045864120 8:106845458-106845480 CTTGGCTGGAAAAAGGAAGTAGG - Intergenic
1045917389 8:107488396-107488418 CTTGGAGGGCCAAGGGAAGAGGG + Intronic
1046287573 8:112114888-112114910 CTTGGAGATCAGAAGCAAGATGG - Intergenic
1046301521 8:112298781-112298803 AATGGAGAGAAAAAGAAAGTTGG + Intronic
1047521815 8:125600757-125600779 CTTGGGGAGCAGAAGGGAGGAGG + Intergenic
1047947334 8:129894769-129894791 CTGGAAGAGCAAAAGGAACAAGG - Intronic
1048408430 8:134146574-134146596 CTTAGAGAGGTAAAGGAATTTGG + Intergenic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1049721523 8:144117962-144117984 CTTGGGGAGAAAAAGGAGGGTGG + Exonic
1049856307 8:144864166-144864188 CTTGGCCAGCAAACAGAAGTTGG + Intergenic
1050663260 9:7907040-7907062 TTTTGAGAGCAAAATGAACTTGG - Intergenic
1050778785 9:9303978-9304000 GTTGGAGAGTAGAAAGAAGTAGG - Intronic
1050980933 9:12014693-12014715 CTTGGAGGCCAAAAGGAAGTGGG + Intergenic
1052108976 9:24556030-24556052 CTTAGAGAGACAAAGGAATTTGG + Intergenic
1052254409 9:26437420-26437442 CTTGGAACTCAAAGGGAAGTTGG - Intergenic
1055433622 9:76270426-76270448 GCTGGAGAGCCAAAGGGAGTGGG - Intronic
1055450410 9:76426222-76426244 CTTGGAGGTTAAAAGGAAGATGG + Intronic
1056202359 9:84288939-84288961 TCAGGAGAGCAAAAGGAAGATGG - Intronic
1056373901 9:85987950-85987972 CTTGGAAAGGCAAAGGAGGTGGG + Intronic
1057239385 9:93394912-93394934 TTTGGAGGCCAGAAGGAAGTGGG - Intergenic
1057518294 9:95739564-95739586 CCTGGAGAGAAATGGGAAGTGGG + Intergenic
1057828524 9:98389677-98389699 CTTCAAGAGCACAAGGAACTCGG + Intronic
1057839760 9:98476887-98476909 TTTGTAGAGCAAAAGCAAGCAGG + Intronic
1058483659 9:105422096-105422118 CTTGAGGATAAAAAGGAAGTTGG - Intronic
1059285219 9:113166530-113166552 CTGAGAGAGCGAGAGGAAGTGGG + Intronic
1059539747 9:115118464-115118486 CCTGGGGAGCAAGAGGGAGTAGG + Intergenic
1059771981 9:117435228-117435250 TTTGGGGATCAAAAGGAACTGGG + Intergenic
1061196378 9:129109352-129109374 CCTGGAGAGAAACAGGAAATAGG - Intronic
1185820387 X:3197370-3197392 CTTAGAGGGCAAAGGAAAGTTGG + Intergenic
1187138254 X:16569367-16569389 CTTGAAGAGAAAAAGGACATGGG - Intergenic
1188043042 X:25392715-25392737 CTTTGAGAAGAAAAGGATGTGGG + Intergenic
1189098077 X:38160872-38160894 TTAGAAGAGCAAAGGGAAGTAGG - Intronic
1189189300 X:39084118-39084140 CTTGGAGGCCAGAAGGAAGTGGG + Intergenic
1189401044 X:40668915-40668937 CTTGGAGAGCAATAAGAGGGGGG + Intronic
1190455629 X:50625398-50625420 CTTAGAGAGGAAAAAGAAGCAGG + Intronic
1191793545 X:64997167-64997189 CATGGAGGCCAAAAGGCAGTGGG + Intronic
1191839189 X:65498492-65498514 CTAGGAGACCAAAAGGAAAGGGG + Intronic
1192298853 X:69879695-69879717 CTTTAAGAGGAAAAGGAAGATGG + Intronic
1192960559 X:76126609-76126631 CATGGAGAGCAAAGAGAAGCAGG + Intergenic
1194046102 X:89005423-89005445 GTTGGAGAGCAAAAAAAAATAGG - Intergenic
1194984119 X:100471681-100471703 ATTGGAGGGCAAAAGGAAGCTGG - Intergenic
1195268886 X:103211712-103211734 CTTGGAGAGAAAAAAGGAGTAGG + Intergenic
1195965506 X:110426729-110426751 CTTAGAAAGGAAAAGGAAGACGG - Intronic
1196145635 X:112313918-112313940 AAGGGAGATCAAAAGGAAGTGGG + Intergenic
1197138891 X:123094864-123094886 CATTGAGAGCTAAATGAAGTAGG - Intergenic
1197398534 X:125959204-125959226 CTTGGAGGCCATAAGGCAGTAGG + Intergenic
1197494124 X:127155850-127155872 TTTGAAGACCAGAAGGAAGTGGG - Intergenic
1198059251 X:133027768-133027790 TTGAGATAGCAAAAGGAAGTGGG - Exonic
1198444518 X:136698576-136698598 CTTGGAGGCCAGAAGGCAGTGGG + Intronic
1198532220 X:137558318-137558340 CCTAGAGAGCAAAGGGAAGGGGG + Intergenic
1198729016 X:139707441-139707463 CTTGGAGAGCAAAGAAAAATGGG - Intronic
1199143488 X:144337134-144337156 TCTGGAGAGCAAAAGGGACTAGG + Intergenic
1199717835 X:150518812-150518834 CTTGGAGACCAAGAGGATTTGGG - Intergenic
1200797871 Y:7358234-7358256 CTTGGGGAGGAAAAGGCAGGAGG - Intergenic