ID: 967597566

View in Genome Browser
Species Human (GRCh38)
Location 3:191345161-191345183
Sequence GCATCTTCTAAGAATAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967597566 Original CRISPR GCATCTTCTAAGAATAGACA AGG Intronic
901322289 1:8347163-8347185 CCATCTGCTAGGAATAGACCTGG - Intergenic
901484690 1:9550606-9550628 GTATTTTGTATGAATAGACATGG + Intronic
904530771 1:31167565-31167587 GCATCTCCTAATAATAGTAATGG - Intergenic
905243013 1:36593425-36593447 GCATTTGCTAAGAAAGGACAGGG + Intergenic
905305686 1:37016219-37016241 GCAGCTGCTAGGAATACACAGGG + Intronic
905999777 1:42414413-42414435 GACTCTTCAAAGAAGAGACAGGG - Intronic
907393714 1:54175325-54175347 GCAGCTGCTCAGAAGAGACAAGG + Intronic
910105358 1:83626183-83626205 GCAGCTTCTAGAACTAGACAGGG + Intergenic
911151439 1:94600193-94600215 GCATGTTTTTAGAATGGACATGG + Intergenic
912658085 1:111505478-111505500 TCATGTTCTCTGAATAGACAAGG + Intronic
919118967 1:193315253-193315275 CCATCTTCTGAGAATAGAAACGG + Intergenic
919401918 1:197129197-197129219 GCATCTTTACAGAAGAGACAAGG + Exonic
921758727 1:218887512-218887534 CCATTTTCTAAGAAAATACAAGG - Intergenic
923778444 1:237000217-237000239 GCTTCTCATAAGAATAGAAATGG + Intergenic
924141334 1:241026969-241026991 GCATGTTTTAAGAAAAAACAAGG + Intronic
1064843883 10:19629256-19629278 GCATCCTCTAAGGAAAGGCATGG + Intronic
1065671447 10:28123418-28123440 CCATCTGCTAAGTATAGACTTGG + Intronic
1069143047 10:64852385-64852407 GCTTTTTCTAATAATTGACATGG + Intergenic
1072275394 10:93817542-93817564 GCATCTTCCATGAACAGAAAGGG - Intergenic
1077683451 11:4268779-4268801 GCATCTTGGAAGAACAGACTAGG - Intergenic
1077686589 11:4297982-4298004 GCATCTTGGAAGAACAGACTAGG + Intergenic
1077691742 11:4349172-4349194 GCATCTTGGAAGAACAGACTAGG + Intergenic
1077884683 11:6378223-6378245 GCTTCTTCAGAGAATAGAGATGG + Intergenic
1080754895 11:35187872-35187894 GCACTTTTTAAAAATAGACATGG + Intronic
1082059430 11:47847990-47848012 GCGTCTTCTGAGAAATGACAGGG + Intronic
1083706482 11:64519895-64519917 GCATCTGGAAAGAATAGATAGGG - Intergenic
1087470257 11:98565151-98565173 GCATCTTCTTATATTTGACAAGG + Intergenic
1088035193 11:105303287-105303309 GCATCTTCTATGTATAGGGATGG - Intergenic
1089752268 11:120660300-120660322 GCATCTTCTATGAATCCTCATGG - Exonic
1090997829 11:131883216-131883238 GCATCTTCTAATAATTAAAAAGG + Intronic
1091239901 11:134045427-134045449 TCAGCTTCTAAGAGTAGAGAAGG - Intergenic
1091345895 11:134853782-134853804 GCATCTTCTCAGCAGAGAAAGGG - Intergenic
1091588076 12:1827391-1827413 GCAGCTGCTAGGAAGAGACAGGG - Exonic
1091718654 12:2796430-2796452 GCTTCCACGAAGAATAGACAGGG - Intronic
1096822982 12:54251710-54251732 GAATTTTTTAAGAATAGAAAGGG - Intronic
1100283394 12:93140255-93140277 GCATCTGCCAAGATCAGACAAGG + Intergenic
1101687635 12:107041565-107041587 GCAGCTTCTAAAAATACACATGG - Intronic
1101735038 12:107457032-107457054 GCATTTTTTAAGTAGAGACAGGG + Intronic
1104489503 12:129181737-129181759 GAATCTTCTAAGAATAAATAGGG - Intronic
1106605096 13:31221682-31221704 GCATCCTCTAAGAATACCAAAGG - Intronic
1107292658 13:38873930-38873952 ACATCTTCTAAAACAAGACACGG - Intronic
1108227673 13:48305398-48305420 GCATGTTCTGGGAAAAGACATGG + Intronic
1108562885 13:51664240-51664262 GGAGCTTCTCAGAAAAGACAGGG - Intronic
1109524616 13:63558515-63558537 GAATTTTCTAAGAAAAGAAATGG + Intergenic
1110474061 13:75892481-75892503 GCAGCTTATTAGAATAAACAGGG + Intergenic
1111314170 13:86530517-86530539 GAATCTTCCAAAAAAAGACATGG + Intergenic
1112463823 13:99625838-99625860 GCAGCTCCTAAGAAGAGAGAAGG + Intronic
1112808589 13:103190251-103190273 GCAGCTTCTAAGAGCAGGCAGGG + Intergenic
1113380273 13:109797658-109797680 GCATCATCTTGGAATAGAGACGG + Intergenic
1115308393 14:31955648-31955670 GCTTCTTCTTAGAAGACACAAGG + Intergenic
1116996397 14:51329468-51329490 GCATATTCTAACACTTGACATGG + Intergenic
1117328266 14:54688546-54688568 GCTGCATCTAAGGATAGACAGGG - Intronic
1119135173 14:72211681-72211703 GAATCATCTTAGAATAGACTTGG + Intronic
1119583687 14:75811815-75811837 GTATCTTCTAAGAATCAACAGGG + Intronic
1120573886 14:86156937-86156959 GCATCTTCAATGAGTAGACGAGG - Intergenic
1122159755 14:99774388-99774410 GCATCTTTTAACAATCGCCATGG - Intronic
1129208322 15:74050683-74050705 GCATCATCTGCGAATAGAGATGG + Intergenic
1138796113 16:59971311-59971333 GCCTCCTCTAGGAAAAGACAAGG - Intergenic
1139011379 16:62638763-62638785 GAATGTTCTAAGAATAGATTTGG + Intergenic
1146537467 17:33665525-33665547 CAATCTTTTAAGAAAAGACAAGG + Intronic
1148133361 17:45275665-45275687 CCAGCTTCTGAGAGTAGACATGG - Intronic
1148716054 17:49716890-49716912 GCATGATCTAACAATACACATGG - Intronic
1149356864 17:55848095-55848117 GCATTTTCTTAGTAGAGACAGGG + Intergenic
1149557773 17:57586424-57586446 GCATTTTATAAGGACAGACAGGG - Intronic
1149899135 17:60457600-60457622 GCATTTTCTTTGAAGAGACAGGG + Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1156829955 18:41479975-41479997 TCATCTGCTGAGAATTGACAGGG + Intergenic
1160319726 18:77878977-77878999 CCATCTACCAAGTATAGACATGG - Intergenic
1164815544 19:31199050-31199072 GTATCGTCAAAAAATAGACAAGG + Intergenic
1164817042 19:31212281-31212303 GCATCTTTTCAGTAGAGACAGGG - Intergenic
1167305194 19:48704081-48704103 GCATCTTCACAGAAGAGAGATGG - Exonic
925596510 2:5560879-5560901 GCATCTTCAAACAAATGACAAGG + Intergenic
926371495 2:12183306-12183328 CCATCTTCTTAGAATAGGAAGGG + Intergenic
926652539 2:15362170-15362192 GAATCTTCTCAGAATAGATTGGG - Intronic
928973933 2:37063625-37063647 GCAACTGCTATGAATGGACATGG + Intronic
933230059 2:79796797-79796819 GCATCTTTTTAGCATGGACAGGG - Intronic
934064434 2:88327552-88327574 GCATCTAGTAGGAATAGACAAGG - Intergenic
935846944 2:107176068-107176090 GCAACTTCAAAGAATAAGCAAGG + Intergenic
936271380 2:111051985-111052007 GCATCTTCTCAGGTTAGGCAAGG - Intronic
936971189 2:118177779-118177801 GCAGCTTCTACAAATAGAAAGGG - Intergenic
937045854 2:118851160-118851182 GCATTTTCTGAGGATAGGCAGGG + Intergenic
938079368 2:128361423-128361445 CGCTCTTCTAAGAAGAGACACGG + Intergenic
939247965 2:139649345-139649367 GCATGTTCTAACCAAAGACAAGG + Intergenic
939952152 2:148488263-148488285 TCATCTACTAAGAATAGTCTCGG + Intronic
940677782 2:156746332-156746354 GCCTCTTCTTAGAATAGTAAAGG + Intergenic
942300230 2:174554116-174554138 GCATCTTCTCACAACAGAGACGG - Intergenic
944646148 2:201782574-201782596 GGATCTTCTAAGAAGAAAGAGGG - Intergenic
947236052 2:227942123-227942145 GAATCATCTAAGAATTGAGAGGG - Intergenic
947794867 2:232887925-232887947 GCATATTCTAAAAAGACACACGG + Intronic
948760274 2:240185972-240185994 GCTTCATCTAAGAATGGACTGGG - Intergenic
1175494770 20:59406116-59406138 GAAACTTCTAAAAATAAACATGG - Intergenic
1175620587 20:60443788-60443810 GATTCCTCTAAGAATAGAAAAGG + Intergenic
1175644852 20:60662506-60662528 ACAGCTTCTCAGAATAAACAGGG - Intergenic
1177058908 21:16346431-16346453 GCATCCACTAAAAATATACAAGG - Intergenic
1177584072 21:23067016-23067038 TCATCTTTTAAGAATAGTCATGG + Intergenic
1178458074 21:32774454-32774476 GAATCTTCTATGATTAGAAAAGG - Intergenic
1180629787 22:17220545-17220567 GTTACTTCTAAGAATAGTCATGG - Intronic
1181991731 22:26842086-26842108 GGAACTTCTAAGAATTGAAAGGG + Intergenic
1182002515 22:26931578-26931600 GCTTCTGCTAAGTACAGACATGG + Intergenic
1182176835 22:28298791-28298813 GCATCTTCTAGGAAAAAATATGG - Intronic
1184715189 22:46277945-46277967 CCACCTTCTAAGAATCAACACGG - Intronic
951428616 3:22580137-22580159 GCATCTTCTAAGATTTTTCAAGG - Intergenic
951727766 3:25779107-25779129 GCATTTTTTAAGTAGAGACAGGG + Intronic
953159686 3:40406763-40406785 GCATTTTCTAGGAAAAGCCAAGG - Intronic
956259655 3:67324867-67324889 GCATCCTCTAAGAAGACAGAGGG - Intergenic
956936885 3:74112603-74112625 GTGTCTTCTAAGCAGAGACAGGG - Intergenic
956953284 3:74307536-74307558 TCATCATCTAAGAAAATACAGGG - Intronic
958534339 3:95378888-95378910 AAATGTTCTAAGAAAAGACAAGG - Intergenic
962662610 3:137619031-137619053 GCCTCTTCTAAGGATGGAGAAGG + Intergenic
963928846 3:150980742-150980764 ACTTCTTCAAAGAAGAGACATGG + Intergenic
967597566 3:191345161-191345183 GCATCTTCTAAGAATAGACAAGG + Intronic
967620270 3:191624996-191625018 GAAATTTCTAAAAATAGACAAGG - Intergenic
968588407 4:1445596-1445618 GCATATTCGAAGGATAAACAGGG - Intergenic
969040005 4:4288784-4288806 GAATATTTTAAGAATAGTCAAGG - Intronic
972804568 4:42515306-42515328 GCAGCTACTAAGAATAGATGTGG + Intronic
973113614 4:46426888-46426910 GAATCTTCTAAAAAAAGAAAGGG - Intronic
974516205 4:62915108-62915130 GCATATTCTAAGAATATACGGGG + Intergenic
974602466 4:64102969-64102991 CCAATTTCTAAGATTAGACAAGG - Intergenic
980127673 4:128789066-128789088 GTATCTTCAAAGAAAAGACAGGG + Intergenic
981950566 4:150401549-150401571 GTAACTTCTAAGAATTTACATGG + Intronic
982555252 4:156853598-156853620 GTATCTCCTAAGAATACAGAAGG + Intronic
986331978 5:6723905-6723927 GCAACTTCTAAGAATACTCCAGG - Intronic
986839050 5:11674898-11674920 GCATTTTTTAAGTAGAGACAGGG + Intronic
988684035 5:33510991-33511013 GAATCCTCTAAAAATAGAAATGG + Intergenic
990686177 5:58303673-58303695 GAGTCTACTAAGAATTGACAAGG - Intergenic
990855017 5:60255381-60255403 GGAACTTCTCAGAATACACAAGG + Intronic
992111826 5:73501638-73501660 GCCTGTTCAAAGAATAGCCAAGG + Intronic
992140602 5:73793350-73793372 ACATTTTCTAAGCATAAACATGG + Intronic
992808343 5:80360785-80360807 ACTTCTCCTAAGAATAGAAATGG - Intergenic
994141538 5:96347119-96347141 GCCTCCTCAAAGAATAGTCACGG - Intergenic
996168872 5:120263723-120263745 GCTTATTCTAAGACTAGAGAAGG + Intergenic
1000201101 5:159011976-159011998 GCATTTTCTAAGCAGAGACCAGG - Intronic
1003716951 6:8658152-8658174 TCATTTTCTAAATATAGACAAGG + Intergenic
1005209431 6:23443416-23443438 TCACCTTCAAAGAATAGACTGGG - Intergenic
1006255728 6:32830494-32830516 GCCTCTGCTAAGAAGAGAAATGG - Intronic
1009305698 6:62087081-62087103 GAATCTTCTAGAAAGAGACAAGG - Intronic
1011995836 6:93586656-93586678 GCATCTTTTATAAATAAACATGG - Intergenic
1015050738 6:128836373-128836395 TAATATTCTAAGGATAGACATGG - Intergenic
1030123874 7:106136362-106136384 GGATTATCTAAGAATAGAAATGG - Intergenic
1030199935 7:106892263-106892285 GCAGGTTATAAGTATAGACAAGG - Intronic
1030460792 7:109833406-109833428 ACATATTCTAAAAATAGAGAAGG - Intergenic
1030477074 7:110049446-110049468 CAATCTTCTAGGACTAGACAGGG - Intergenic
1031108813 7:117580984-117581006 ACATTTTCTCAGAAAAGACAAGG + Intronic
1031277776 7:119752426-119752448 GCATGTTCTATGAATAAAAATGG + Intergenic
1033533905 7:142294156-142294178 GGATCTTCAAAGAAAAGTCAAGG - Intergenic
1033637856 7:143228618-143228640 CCACCTGCTAAGGATAGACACGG + Intergenic
1034594592 7:152177681-152177703 GCATCTTCTAATCTGAGACATGG - Exonic
1036191820 8:6677909-6677931 GCCTCTTCTAAAAGTACACATGG - Intergenic
1037708543 8:21336202-21336224 GCATGTTCTAAGAACAGGAAGGG - Intergenic
1038698653 8:29828939-29828961 GAGTCTTCTAAGCATACACAGGG - Intergenic
1042483632 8:69329391-69329413 GCCTCATCAAAGAATAGATAAGG + Intergenic
1043641721 8:82459968-82459990 GCACCTGCTAAAGATAGACATGG + Intergenic
1044591932 8:93921617-93921639 GCATTTTTTAAGAATAGGGAGGG + Intronic
1049592947 8:143470929-143470951 GGATCTTCTCAGAATAGACTCGG + Intronic
1050397213 9:5211675-5211697 GCATCTTCTAAAAATCCACATGG - Intergenic
1050453709 9:5811248-5811270 GCTGCTTCTAAGTATCGACATGG - Exonic
1051768475 9:20549848-20549870 GCATGTGCTAAGAAGAGAGATGG - Intronic
1057474075 9:95384164-95384186 GCATCTCCCAAGTATAGAAAAGG - Intergenic
1058746129 9:107992357-107992379 AAATCTTCTAAGAAAATACAGGG + Intergenic
1059739156 9:117132819-117132841 GCATCTTCAAAGATAAGAAATGG - Intronic
1187356541 X:18578344-18578366 GCATCTTTTATAAATAGGCATGG + Intronic
1188050661 X:25481393-25481415 ACATCTGCTAAGAATTAACAGGG - Intergenic
1188575470 X:31644780-31644802 GCCTCTTCTTAGAGTAGACCAGG + Intronic
1188783757 X:34318391-34318413 GACTCTTCTGAGAATAGAAAAGG + Intergenic
1193342993 X:80373566-80373588 GAATCTTCTTATAATAGATAAGG + Intronic
1199781733 X:151067651-151067673 GTATTTTTTAAGAAGAGACAGGG + Intergenic
1200320365 X:155182241-155182263 AAATCTTCTAAGAAAAGAAAGGG - Intergenic
1201603863 Y:15763683-15763705 GCATCTTCCAGAAATAGTCAAGG + Intergenic