ID: 967598561

View in Genome Browser
Species Human (GRCh38)
Location 3:191357104-191357126
Sequence TGTCCTGGAGGACCACACCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967598557_967598561 6 Left 967598557 3:191357075-191357097 CCATCTACTCTAGTATGCCGAGA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 967598561 3:191357104-191357126 TGTCCTGGAGGACCACACCCTGG 0: 1
1: 0
2: 1
3: 25
4: 176
967598555_967598561 22 Left 967598555 3:191357059-191357081 CCTGTCTGTTTTTCCTCCATCTA 0: 1
1: 0
2: 5
3: 30
4: 396
Right 967598561 3:191357104-191357126 TGTCCTGGAGGACCACACCCTGG 0: 1
1: 0
2: 1
3: 25
4: 176
967598556_967598561 9 Left 967598556 3:191357072-191357094 CCTCCATCTACTCTAGTATGCCG 0: 1
1: 0
2: 0
3: 4
4: 34
Right 967598561 3:191357104-191357126 TGTCCTGGAGGACCACACCCTGG 0: 1
1: 0
2: 1
3: 25
4: 176
967598554_967598561 26 Left 967598554 3:191357055-191357077 CCTTCCTGTCTGTTTTTCCTCCA 0: 1
1: 0
2: 6
3: 82
4: 775
Right 967598561 3:191357104-191357126 TGTCCTGGAGGACCACACCCTGG 0: 1
1: 0
2: 1
3: 25
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967598561 Original CRISPR TGTCCTGGAGGACCACACCC TGG Exonic
900502894 1:3015299-3015321 TGCCCTGGAGGAACACAGGCAGG - Intergenic
900524386 1:3121380-3121402 TGTCCTGGAGGAAAGCAACCTGG + Intronic
900528705 1:3142152-3142174 CTTCCTGGAAGACCAGACCCCGG - Intronic
901190518 1:7407347-7407369 TGTCTTGGGGGACCACAGACAGG + Intronic
902782917 1:18716207-18716229 TGTCCTGGGGGACCCGACCCAGG - Intronic
902977390 1:20098765-20098787 TCTTCTGGGGAACCACACCCAGG + Intergenic
903328856 1:22586689-22586711 AGGCCTGGAGGACCAAACACAGG - Intronic
904629310 1:31829427-31829449 TGTCCTGCTGGACCTCAGCCAGG - Intergenic
904773805 1:32894921-32894943 TGTCCTGGAGGAGGAGACCCAGG - Intronic
905298172 1:36967932-36967954 TGTCCTGAAGGACCTGGCCCCGG + Intronic
905401922 1:37709948-37709970 TGTCTGGGAGGACAACACCTAGG + Intergenic
907408312 1:54267623-54267645 AGTCCTCTAGAACCACACCCAGG - Intronic
913349547 1:117842554-117842576 TGCCCTGGGGGCCCACACCATGG + Intergenic
915170789 1:153975874-153975896 TATCCTGTGGGACCACACTCAGG + Exonic
919747314 1:201016951-201016973 TTTCCTGGAGTATCACACCCAGG - Intronic
919786162 1:201259870-201259892 TTCCCTGGGGGTCCACACCCTGG - Intergenic
919842558 1:201619787-201619809 AGGCCTGGAGGGCCACACCCAGG - Intergenic
920144467 1:203846798-203846820 TTTCCTTGAGGACCACTGCCTGG + Intronic
920164755 1:204028077-204028099 TGTTCTGGAAGACCAGACCCTGG + Intergenic
921377200 1:214486688-214486710 TTTGCTGGAGGCACACACCCAGG + Intronic
923356464 1:233160802-233160824 TGTCTGGAAGGACCACAGCCAGG + Intronic
923532872 1:234825403-234825425 TCTCCTGGAGGTCAACACCTGGG + Intergenic
1063374436 10:5545723-5545745 TGAGCTGGAGCCCCACACCCAGG + Intergenic
1063958012 10:11283708-11283730 TGTCCTGGAGGGGGACTCCCTGG + Intronic
1067722105 10:48735881-48735903 TGTCCTGAAGGACCACGGCATGG + Exonic
1067907344 10:50307265-50307287 TGGCCTGTACCACCACACCCTGG + Exonic
1069728900 10:70598691-70598713 TGGCCTGGTGGACTACACCCTGG - Exonic
1072337627 10:94412947-94412969 ATTCCTGGTGGACCCCACCCAGG - Intronic
1072657064 10:97337157-97337179 TTGCCTGGAGTCCCACACCCAGG - Intergenic
1075686461 10:124368115-124368137 TCTCCCCGAGGACCACAGCCTGG + Intergenic
1077338418 11:2015609-2015631 TGTCCCTGAGGCCCACACCTTGG + Intergenic
1077361317 11:2141323-2141345 TGTCCTGGAGGAGGGGACCCCGG + Intronic
1077418034 11:2434800-2434822 GGGCCAGGAGGACCACAGCCTGG + Intergenic
1079745479 11:24123277-24123299 TGTCCTGGAGGAGAACCCCTAGG + Intergenic
1080491674 11:32771357-32771379 TGTACTAGGGGACCACTCCCGGG + Intronic
1081686362 11:45045990-45046012 CGACCTGGAGCACCACATCCCGG - Intergenic
1082696422 11:56370804-56370826 TGTTCTGGAGGCCAACACACTGG + Intergenic
1083746032 11:64736917-64736939 GGTCCTTGAGGTGCACACCCAGG + Exonic
1084589432 11:70081819-70081841 TGTCCTGGAAGACCTGTCCCAGG - Intronic
1084946977 11:72643484-72643506 CGGCCAGGAGGACCAAACCCGGG + Intronic
1086520274 11:87661206-87661228 TCTCCTGGTGGAAAACACCCTGG - Intergenic
1088877201 11:113945876-113945898 TGTGATGGAGGAAAACACCCTGG - Intronic
1089277082 11:117344518-117344540 TGTGCTAGAGAACCAGACCCAGG - Intronic
1089774105 11:120824301-120824323 TGACCAGGAGGACCACACCTGGG - Intronic
1090840314 11:130481880-130481902 TGGCCTGGACGACCACAGCCTGG + Intergenic
1202821402 11_KI270721v1_random:70791-70813 TGTCCCTGAGGCCCACACCTTGG + Intergenic
1091593102 12:1857053-1857075 TCTCCTGGAGGAGTGCACCCTGG + Intronic
1091772002 12:3158178-3158200 TGTCCCGGAGGAGCATCCCCTGG + Intronic
1091937247 12:4443745-4443767 TGTCATGGAGCAGCGCACCCAGG + Intronic
1092518686 12:9242761-9242783 GGTCCTGGAAGACAACACACAGG + Intergenic
1092661855 12:10747508-10747530 TTTGCTGGAGGTCCACACCTGGG + Intergenic
1095486472 12:42689839-42689861 GTTCCTGGAGGACCACACGCTGG + Intergenic
1101568720 12:105933957-105933979 TCTCCTGGAGGACCACACAGGGG + Intergenic
1104641504 12:130470151-130470173 TGTTTGCGAGGACCACACCCGGG + Intronic
1104876131 12:132036094-132036116 TGTCGTGGAAGGACACACCCGGG + Intronic
1104876163 12:132036296-132036318 TGTCGTGGAAGCACACACCCAGG + Intronic
1112352288 13:98646254-98646276 TTCCCTGCAGGACCACAGCCTGG - Intergenic
1118820049 14:69339175-69339197 TGTCCTAGAAGACCACTCCACGG + Intronic
1119520606 14:75281560-75281582 AGTCCTTGAGGCCCACAGCCTGG - Exonic
1119767877 14:77201837-77201859 TGTCCTGGGGGCCCAGCCCCAGG - Intronic
1123448519 15:20346047-20346069 TCGCCTGGAGGACAAAACCCAGG + Intergenic
1123811449 15:23930319-23930341 TGTCATGGATGACTAAACCCTGG + Intergenic
1124962675 15:34410163-34410185 CGTCCTGGAGGCCCACGACCAGG + Intronic
1124979300 15:34556385-34556407 CGTCCTGGAGGCCCACGACCAGG + Intronic
1126491808 15:49245486-49245508 TGACCTGTATGACCACACCTGGG + Intronic
1128220526 15:65965186-65965208 TGGCCAGGAGGACCACATCCTGG - Intronic
1129228249 15:74182219-74182241 TGTTCTGCAGGATCACAGCCAGG + Exonic
1133457178 16:5952781-5952803 TGTCCTGGAGAAACTCTCCCAGG - Intergenic
1136397161 16:29999394-29999416 CGTCCTGGAGGCCCACGCCCTGG + Intronic
1142015800 16:87746521-87746543 TGACCTGCGGAACCACACCCTGG + Intronic
1142029918 16:87833356-87833378 CTTCCTGCAGGTCCACACCCGGG + Intronic
1143026679 17:3945217-3945239 GGGCCTGCAGGACCCCACCCTGG - Intronic
1144520973 17:15951985-15952007 TGCCCTGGAGCAGCACAGCCAGG + Intronic
1144619968 17:16812254-16812276 TGTCCTGGAGGAACTCAGTCCGG - Intergenic
1144809352 17:17988836-17988858 TGTCCAGCAGGACCAAATCCAGG + Intronic
1144892719 17:18503450-18503472 TGTCCTGGAGGAACTCAGTCCGG + Intergenic
1145139494 17:20440837-20440859 TGTCCTGGAGGAACTCAGTCCGG - Intergenic
1146525304 17:33562540-33562562 TGTCCTGGAGGGCCACCACCAGG + Intronic
1147662770 17:42125821-42125843 TCTCCTGGAGGTCCACACCTCGG + Exonic
1148885414 17:50768590-50768612 TTTTATGGCGGACCACACCCTGG - Intergenic
1149929944 17:60741512-60741534 TGTCCTGAAGGACCACAGATAGG - Intronic
1150503724 17:65676934-65676956 TGGCCTGGAGCACCACCCCTTGG + Intronic
1152340269 17:79720542-79720564 TCGCCTGGAGGACAAAACCCAGG - Intergenic
1152422512 17:80201779-80201801 AGTCCTGGAGGACACGACCCTGG + Exonic
1152918132 17:83052367-83052389 TCTCCTGGGGGACCTCGCCCCGG - Intergenic
1154046061 18:10905951-10905973 TGTCCTGATGGCCCACTCCCAGG - Intronic
1154354544 18:13615050-13615072 TTTCCTGGAGCACCAAACCCAGG - Intronic
1157719372 18:49912061-49912083 TGTCCTGGAGAACCTCATCAAGG - Exonic
1159763405 18:72456308-72456330 TGGCCTGCAGGACCACACAGGGG - Intergenic
1160542058 18:79629250-79629272 TGGCACGGGGGACCACACCCGGG + Intergenic
1160657391 19:280594-280616 AGGCCTGAAGGACCACACACAGG - Intergenic
1161017413 19:1990166-1990188 TGTCCTGGAGCGCGACACACTGG - Exonic
1161169159 19:2804462-2804484 TTTCCTGAAGAACCACCCCCAGG - Intronic
1163586858 19:18168984-18169006 TGTCCCGGATGACCCCACCAGGG - Intronic
1163594535 19:18213388-18213410 TGTCCAGGAGGAGGACACCGAGG + Exonic
1165059899 19:33199995-33200017 TGTCCTGGAGGACAAGGCCAGGG - Intronic
1167715100 19:51137993-51138015 TGTCCTGGAGGGTCAGTCCCTGG + Intergenic
1168404098 19:56101946-56101968 TGCCCAGGGGGCCCACACCCCGG - Intronic
925178834 2:1803651-1803673 TGTCCTGGGGGACCACCCTCAGG + Intronic
925384910 2:3455052-3455074 TGACCTGGTGCGCCACACCCCGG + Intronic
930090326 2:47527184-47527206 AGTCCTCCAGGACCACAGCCAGG + Intronic
932290296 2:70571264-70571286 TTTCCTGGATGACATCACCCAGG + Intergenic
934721094 2:96577377-96577399 TGTCCTGGAGGATCTAAGCCAGG - Intergenic
935148984 2:100417257-100417279 TGTCCTGGCGAGCCACATCCCGG - Intronic
937671960 2:124547600-124547622 ACTCTTGGAGGACCACACCATGG - Intronic
945666704 2:212752900-212752922 TGTCATGCAGGGCCACACCAGGG + Intergenic
946405764 2:219491326-219491348 TGGCCTGTAGAACCACACCAAGG - Intronic
946834490 2:223759378-223759400 TGATCAGGAGGACCACATCCAGG + Intronic
948032253 2:234828467-234828489 TGGCCTTGTGGACCCCACCCAGG - Intergenic
1168898728 20:1341949-1341971 TGTCCTTTGGGACCACAGCCCGG - Intronic
1169877229 20:10311519-10311541 TGTTCTGGAGGAGCAATCCCAGG + Intergenic
1175722648 20:61296710-61296732 TGTTCTGGAAGGCCAGACCCAGG + Intronic
1176058466 20:63161245-63161267 GGTCCTGGGGCACCACACCAGGG + Intergenic
1178473797 21:32918657-32918679 TCTCCTGGAGAACCACAACTGGG + Intergenic
1179041821 21:37809866-37809888 TGACCTGGGGATCCACACCCTGG + Intronic
1179138561 21:38701703-38701725 TTTCCTGCAGGACCACATCCAGG + Intergenic
1179469885 21:41603468-41603490 TGTCTTGGAGCACCACAGGCTGG + Intergenic
1180106551 21:45622649-45622671 TGCCCTGGGGAACCACATCCTGG + Intergenic
1180260236 21:46663373-46663395 TGTCTTGCAGCACCACACACTGG + Exonic
1182863229 22:33579535-33579557 TGTCCTGAAGGAGGACATCCAGG - Intronic
1183512253 22:38243193-38243215 CTTCCTGGAGGACCTCTCCCCGG + Intronic
1183666467 22:39249063-39249085 TGTCCTGGACCCCCACGCCCAGG - Intergenic
1184120315 22:42445760-42445782 TGGCCTGGAGGACCCAGCCCTGG + Intergenic
1184198912 22:42951568-42951590 TGTCCTGGAGGAGCCCAACCGGG - Intronic
1184273754 22:43399025-43399047 TGTCCTGGAGGAGCCCAGGCCGG + Intergenic
1184667484 22:45996549-45996571 TGGCCTGGAGGTCCCCTCCCTGG - Intergenic
1184697400 22:46147705-46147727 TGCCCTGGCGGATGACACCCTGG + Intergenic
1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG + Intronic
1185228511 22:49667533-49667555 TGTCCTGCAGGACCCCAGGCTGG - Intergenic
1185406713 22:50656353-50656375 TGTCCTGGAGGGCAACTCCTTGG - Intergenic
1185415151 22:50705594-50705616 TGGCTTGGCTGACCACACCCTGG + Intergenic
950076639 3:10192085-10192107 TGGCCTGGAGGGCCAAACCCAGG + Intronic
950536582 3:13582416-13582438 GGTCCTAGAGGCCCACAGCCTGG - Intronic
950906664 3:16545020-16545042 TGTCCTGGGTGACAAGACCCAGG - Intergenic
952289769 3:32003805-32003827 TGTCCTGGAGGATGACCTCCAGG - Intronic
953410913 3:42690098-42690120 TGTCCAAAAGGACCCCACCCGGG + Intronic
954289534 3:49642436-49642458 GGCCCAGGAGGACCACAGCCTGG + Exonic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961752672 3:129106444-129106466 TTCCCTGGAGGACCACAGCATGG - Intronic
962953633 3:140244194-140244216 AGTCCCGGAGGGCCACATCCAGG - Intronic
963067357 3:141274263-141274285 GGGCCTGGAGGAGCAGACCCCGG - Intronic
964473013 3:157074103-157074125 TGTCCTGCAGGAACACAATCTGG - Intergenic
967598561 3:191357104-191357126 TGTCCTGGAGGACCACACCCTGG + Exonic
968470173 4:777178-777200 TTTCCAGCAGGTCCACACCCTGG + Intergenic
968958238 4:3730015-3730037 CGTCCTCCAGGACCACACCTTGG - Intergenic
971207694 4:24585759-24585781 TGCCCTGGAAGACCATACTCTGG + Intergenic
974069430 4:57110435-57110457 TGTCCGCGGGAACCACACCCCGG + Intergenic
985790738 5:1925764-1925786 TGACCTGGAAAACCACCCCCAGG - Intergenic
985909688 5:2869199-2869221 TGGCCGGGAGGACCACAGTCTGG + Intergenic
986972147 5:13349382-13349404 TCTCCTGGAGCAACACAGCCTGG - Intergenic
987047237 5:14119612-14119634 TGTCCTGGCGGCCCACTCCAGGG - Intergenic
993735929 5:91476963-91476985 TCTCCTGGAGGTCCACACCTTGG - Intergenic
994518453 5:100799039-100799061 TGTCCTATAGGAACACACCTGGG - Intergenic
995533753 5:113115541-113115563 AGTCCTGGAGGACAGCTCCCTGG - Intronic
999772536 5:154786429-154786451 TGTCCCAGAGGACCATAGCCAGG - Intronic
999968160 5:156832083-156832105 TGTCCTGGAGACCCACGACCTGG - Intergenic
1000300359 5:159951003-159951025 TGTCATGGATGACCTCGCCCAGG + Intronic
1001092138 5:168749484-168749506 AGTCCTGGATGGCCACATCCTGG + Exonic
1002261546 5:177996738-177996760 TGTCCTGGAGGCCCATTCTCCGG - Intergenic
1003017259 6:2478147-2478169 TGTCCTGGGGGCCGACACACGGG - Intergenic
1003512530 6:6793209-6793231 GCTGCTGAAGGACCACACCCAGG - Intergenic
1005985424 6:30870786-30870808 AGTCATGGAGAACCACACACTGG + Intergenic
1006142120 6:31935994-31936016 TGTCCTGAACGACAACTCCCGGG + Exonic
1007071237 6:39039844-39039866 TGTCCTTGAGGGGCACCCCCAGG + Intergenic
1007333889 6:41137392-41137414 TGTCCTTGATGCCCACACTCTGG - Intergenic
1008543849 6:52568566-52568588 TGACCTGGAGGAGCAATCCCAGG - Intronic
1011170958 6:84503972-84503994 TCTCCATGAGCACCACACCCTGG - Intergenic
1016753023 6:147651896-147651918 TTTCCTCCAAGACCACACCCAGG + Intronic
1017387408 6:153901806-153901828 TGTCCTGAAGGATGAGACCCAGG + Intergenic
1019600685 7:1882186-1882208 TGGGCTGGATGCCCACACCCCGG + Intronic
1023545266 7:41311872-41311894 AGTCCTGTAGGACCAAACACAGG - Intergenic
1024123739 7:46270832-46270854 TCTCCTAGAGGACCACAGCTGGG - Intergenic
1026340829 7:69432617-69432639 TGACCTGAAGGTCAACACCCTGG + Intergenic
1028522472 7:91747407-91747429 TGCAGTGGGGGACCACACCCAGG + Intronic
1031356409 7:120792271-120792293 TGGCCTGGAAGACCCCACTCAGG + Intronic
1033237611 7:139650583-139650605 TCTCCTGGAAGTCAACACCCTGG + Intronic
1034398978 7:150848881-150848903 TGTCACAGAGGACCACACACAGG - Intronic
1035010218 7:155709005-155709027 TGTCCTGTTGGACCGCACTCTGG + Intronic
1035174148 7:157038561-157038583 TGCCCTGGAGACCAACACCCAGG - Intergenic
1037582371 8:20253267-20253289 TGTCCTGGAGGACGATGCCCTGG + Exonic
1040652756 8:49467200-49467222 TGTCCTGGAGGTCCTCATCCTGG - Intergenic
1041016087 8:53594471-53594493 TGGCATGGAGGGCCCCACCCAGG + Intergenic
1044358333 8:91252579-91252601 TGTCCTGGAGATTCAAACCCTGG + Intronic
1044837140 8:96307013-96307035 TGTCCTGGAGGACTACAGGAAGG - Intronic
1046764540 8:118055596-118055618 TGTCCTGGAAAACCATGCCCTGG - Intronic
1047349527 8:124060427-124060449 TTTCCTGGAGGAACACAGCGTGG + Intronic
1051991789 9:23161202-23161224 TGTCCTTGATGGCCACAGCCTGG - Intergenic
1054763602 9:69024718-69024740 TGTACTGGAGGTCCTCACCAGGG + Intergenic
1056932677 9:90891873-90891895 TTCCCTCCAGGACCACACCCTGG - Intronic
1057008176 9:91578917-91578939 TGTACAGGAGGAGGACACCCAGG - Intronic
1058040419 9:100295963-100295985 TGTCCTGGAGGGTAACACCATGG - Intronic
1058357809 9:104104866-104104888 TGCCCAGGAGGACCACAGGCAGG + Intronic
1059638171 9:116190871-116190893 TGACCTGGTGGGCCTCACCCAGG - Intronic
1060484133 9:124036568-124036590 TGTTCTTGAGACCCACACCCAGG + Intergenic
1061837861 9:133341335-133341357 TGTCCTGGCGGGACCCACCCTGG + Exonic
1062070196 9:134551294-134551316 TGTGCTGGAGGACCCCGTCCTGG + Intergenic
1185985013 X:4823157-4823179 TGACCTGGAGGCCCCCTCCCCGG - Intergenic
1189266100 X:39717275-39717297 TGTCCTAGAGCAGCTCACCCAGG + Intergenic
1190931183 X:54950801-54950823 TATCCTGGATGGCCACACCCTGG - Intronic
1195361077 X:104084473-104084495 TGCCCTGGGGGCCCACACCATGG - Intergenic
1196711657 X:118769797-118769819 TGACCTGGAGCACCACAGCCGGG + Intronic
1198805472 X:140490066-140490088 GGTCCTGGAGGACCACTCTTGGG - Intergenic
1199076785 X:143534536-143534558 AGTCCTGGAGCACCACACACTGG + Intergenic