ID: 967601555

View in Genome Browser
Species Human (GRCh38)
Location 3:191396265-191396287
Sequence GCTGACTGTCAGTCACATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967601555 Original CRISPR GCTGACTGTCAGTCACATAA AGG (reversed) Intronic
901702172 1:11051113-11051135 CCTGACTGTCAGTTACATGGAGG + Intergenic
901892732 1:12281714-12281736 CCTGTCAGTCATTCACATAATGG + Intronic
910857890 1:91714389-91714411 GGTGACTGTTGGTCACATAATGG - Intronic
917150090 1:171933760-171933782 ACTGACTGTAAGTAAAATAAAGG + Intronic
917236573 1:172899092-172899114 CATGACTGTCAGTAAGATAAAGG - Intergenic
918547667 1:185703678-185703700 GCTGTCTGTAAGTCATAAAATGG + Intergenic
918602347 1:186378193-186378215 GTAAACTGTCAGTCACAAAACGG - Intronic
919713036 1:200747196-200747218 GCTGACTGCCAGTCACTTTGAGG + Intronic
919957456 1:202432988-202433010 ACTGAATGTCAGTCACCAAAAGG + Intronic
921295279 1:213695482-213695504 GCTGACTGTGTGTCACTGAAAGG + Intergenic
922463734 1:225832016-225832038 TCTGACTGTAAGTCACATTGTGG - Intronic
923239912 1:232073733-232073755 TCTTAATGTCAGTTACATAAGGG + Intergenic
924182428 1:241452452-241452474 GCTGAGTGGCATTCACAGAAAGG + Intergenic
1068486633 10:57667232-57667254 GCTAACTCTCATACACATAAGGG - Intergenic
1073740205 10:106398111-106398133 GCTTACTGTGAGTAACAAAAAGG - Intergenic
1074679555 10:115890467-115890489 AGGGACTGTGAGTCACATAAAGG - Intronic
1076718672 10:132382538-132382560 GCTTACTGCAAGTAACATAATGG - Intergenic
1076791802 10:132780765-132780787 GCTGACTGGCAGGAACATCAGGG - Intronic
1076810424 10:132883726-132883748 GTGGACTGTAAGACACATAACGG + Intronic
1077336858 11:2009157-2009179 CCTGGCTGTCAGTCACATTGAGG + Intergenic
1078345283 11:10542318-10542340 GCTGGCTGTCAGGGAAATAATGG - Intergenic
1086948314 11:92866247-92866269 ACAGACTGTCAGCCACATGAGGG + Intronic
1089403982 11:118182249-118182271 GCTGACTGTCTAGCACATAGGGG - Intergenic
1091179810 11:133594261-133594283 GATTACAGGCAGTCACATAAAGG + Intergenic
1202819842 11_KI270721v1_random:64339-64361 CCTGGCTGTCAGTCACATTGAGG + Intergenic
1093833464 12:23796011-23796033 GCTGTCATTCAGCCACATAAAGG + Intronic
1094768455 12:33624752-33624774 GGTGACTGAAAATCACATAATGG + Intergenic
1095331701 12:40973404-40973426 GCTGAGTGACAGTCATATTAGGG - Intronic
1097096936 12:56556933-56556955 GCTGACTGTAAGCTCCATAAAGG - Intronic
1099569858 12:84303452-84303474 GCAGAGTGTCTGGCACATAATGG - Intergenic
1101399065 12:104372752-104372774 GCTGATTTTCTGTCACATCATGG - Intergenic
1102230999 12:111262177-111262199 CCGGACTGTAAGTCCCATAAGGG + Intronic
1103794529 12:123494276-123494298 GATGCCTGTCAGTCACACAGGGG - Intronic
1111515347 13:89323923-89323945 GCTGACTGACGTTCAAATAATGG + Intergenic
1113136116 13:107091242-107091264 GGTGGCTGTCAGTCACAGGATGG - Intergenic
1118178414 14:63465820-63465842 GCTGACTCTCAGGCACATCCTGG - Intronic
1119370802 14:74140610-74140632 GGTGACTGTCCGTCACGAAAAGG + Intronic
1121122875 14:91387225-91387247 ACTGACTGTCAGTTCTATAAAGG - Intronic
1127333968 15:57965709-57965731 GCTGACTGTAAGTCAACTACAGG - Exonic
1128924711 15:71644639-71644661 GCTGACTTTGAGTCACAGCAAGG + Intronic
1138029585 16:53549510-53549532 GCTGGAAGTCAGTCCCATAAAGG - Intergenic
1142717989 17:1757709-1757731 CCTGACTGCCAGTAACATAGTGG + Intergenic
1143214305 17:5212942-5212964 GATAACTGTCAGTTTCATAAAGG + Intronic
1150608949 17:66717796-66717818 ACAGACTGTCAGCCACAGAAGGG - Intronic
1151916324 17:77120844-77120866 GCTGAATCTCAGTCACACATCGG - Intronic
1153992680 18:10414268-10414290 GCTGACTTTCCATCACAAAACGG + Intergenic
1156797049 18:41058592-41058614 GCTGACTGTCAGTCAGTCAGGGG - Intergenic
1157396476 18:47345843-47345865 GCTGACAGTCATTCACACAGAGG + Intergenic
1158034911 18:53015498-53015520 TATTACTGTCACTCACATAAGGG - Intronic
1160744126 19:702701-702723 GCTGAATGTCAGCCCCACAAGGG - Intergenic
1166276812 19:41759487-41759509 GGTGTGTGTCAGTTACATAAAGG - Intronic
925844621 2:8024295-8024317 GGTGACTGTCAGGCACAGAGGGG + Intergenic
928579235 2:32689723-32689745 GTTGACTCTCAATCACAAAAGGG - Intronic
929942694 2:46347010-46347032 GCTGATTGCCAGTCGCATGATGG - Exonic
930887546 2:56344332-56344354 CCTGCCTGTTAGTCACTTAATGG - Intronic
935238451 2:101157463-101157485 GCTGACTGGCAGTCTGAGAAAGG + Intronic
938380459 2:130833583-130833605 GCTGGCGGTCAGCCACAGAAAGG - Intergenic
940187082 2:150997725-150997747 GCTTACTCTCATTCACATAAAGG - Intergenic
942912112 2:181256555-181256577 CCTGTCTGACAGTCACATGAAGG + Intergenic
944514378 2:200496975-200496997 ACTGACTGCCAGTCACACAATGG - Intronic
948027631 2:234790594-234790616 GCTTATTCTCAGTCACATTAAGG - Intergenic
948340345 2:237245601-237245623 GCTGACTGGCATCCACAGAATGG + Intergenic
948684640 2:239662840-239662862 GATGCCTGTCAGTCTCAAAAGGG - Intergenic
1169177508 20:3531019-3531041 GTTCACTGGCAGTCACACAAAGG - Intronic
1174394344 20:50237479-50237501 GCTGACTGTCCTGCACACAAAGG - Intergenic
1175183964 20:57167353-57167375 GCTCACTGTCAGGCACAGAGAGG - Intergenic
1175737270 20:61395985-61396007 GCTATCTGTCAGCCACATTAGGG - Intronic
1176922347 21:14703545-14703567 GCAGACAGTCGGTCACATTATGG - Intergenic
1177731011 21:25026502-25026524 GCTGACTGGTATTCACAGAACGG - Intergenic
1178616793 21:34141631-34141653 ACTGACCTTTAGTCACATAATGG + Intronic
1179558455 21:42195466-42195488 CCTGACTGTCAGTCACAGGCCGG + Intergenic
1181309693 22:21937893-21937915 GCTGACTGGCAGCCACACAGAGG + Intronic
1182679932 22:32070842-32070864 GGTGACTGTCAGTCTGATAAAGG + Intronic
1184638577 22:45856272-45856294 GCTGCCTGTCATTCCCACAATGG + Intergenic
949437402 3:4044277-4044299 TCTGACTGTCATTCAAACAATGG + Intronic
956566137 3:70640449-70640471 GCTGACTGTTATCCACAAAAAGG + Intergenic
957368631 3:79260134-79260156 GCTGACTTTCAATAACATTATGG - Intronic
957836700 3:85603147-85603169 GCTCAATGTCTGTCAGATAATGG + Intronic
967601555 3:191396265-191396287 GCTGACTGTCAGTCACATAAAGG - Intronic
969263108 4:6046163-6046185 GCAGACTGTCAGTCCCCTAGTGG + Intronic
970086127 4:12348306-12348328 GTTGACTTTCTGTTACATAATGG + Intergenic
973705945 4:53580458-53580480 GCTGTCTGGCAGTCACATCAAGG - Intronic
974138664 4:57852983-57853005 GCTGCCTGACATTCACAGAATGG - Intergenic
977671125 4:99696850-99696872 GCTGACTTTAAGTCACAGGAGGG - Intergenic
981243798 4:142509863-142509885 GCTTACTGTAAGTCAGATACTGG - Intronic
984272529 4:177565020-177565042 GCTGCATGTTAGTCACAGAAAGG + Intergenic
986240910 5:5959054-5959076 GCTGACTGTCAGAGAGATACAGG + Intergenic
987259157 5:16186373-16186395 GCTGACCGTAAGTCACTTGAGGG + Intergenic
987934015 5:24440966-24440988 GCTGACTATCTAACACATAAGGG - Intergenic
995483544 5:112616073-112616095 GCTGACTGGCAGTCACAGAATGG + Intergenic
997244101 5:132331457-132331479 TCTGACTGACAGTCAGAGAATGG - Intronic
997244102 5:132331463-132331485 TCTGACTGTCAGTCAGAGAAAGG + Intronic
997624368 5:135321574-135321596 GCTGACTGCCAGCCAGAAAATGG + Intronic
1002564905 5:180105947-180105969 GCTGCCTATCAGTCACTTAGTGG - Intronic
1005373197 6:25155959-25155981 GCTGACTGTCAGAAATATAGAGG - Intergenic
1005960778 6:30691170-30691192 GCTGTCTCTCCGTCACAGAAGGG + Exonic
1008513669 6:52299782-52299804 GCTGAATGTCAGTGAGATATTGG + Intergenic
1010001260 6:70952262-70952284 GCTGGCTCTCAGACACTTAAGGG - Intronic
1010629496 6:78180539-78180561 GCTGCCTACCAGTCACATACTGG + Intergenic
1012244064 6:96906522-96906544 GATGACTGACAGCTACATAAAGG + Intergenic
1016578916 6:145605552-145605574 GCTGACTGTAAATCTCAAAAAGG + Intronic
1017816168 6:158018061-158018083 ACTGACTGACAGTCACACATCGG - Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1021578012 7:22122450-22122472 GCTGGCTGTCAATGACATACAGG + Exonic
1024152247 7:46583858-46583880 GATGACTGTCAGAGACAAAAGGG + Intergenic
1028174337 7:87635983-87636005 GATGACAGTCAGTGACAGAATGG - Intronic
1028532403 7:91852051-91852073 GCTGACTGCCACTCTCATTAGGG + Intronic
1030377653 7:108772013-108772035 GCCTACTGTCAGCCACATGAAGG - Intergenic
1035916800 8:3634022-3634044 GATTACTGTCAGTGAAATAAAGG + Intronic
1041788885 8:61668975-61668997 TCTCTCTCTCAGTCACATAAAGG + Intronic
1045003503 8:97898169-97898191 GGTGACTGTCACTCACGGAAGGG - Intronic
1047044528 8:121037289-121037311 GCTGACAGTCAGTGAGAAAATGG + Intergenic
1049052140 8:140206918-140206940 GCAGACTGTCTGGCACATGACGG - Intronic
1050242618 9:3653303-3653325 TCTGAATATTAGTCACATAAAGG + Intergenic
1052741680 9:32399096-32399118 GCTGTCTGTCATTCACGTAAAGG + Intronic
1053620983 9:39816450-39816472 GCTTAGTGTCAGTCACAAAGGGG + Intergenic
1054263181 9:62890992-62891014 GCTTAGTGTCAGTCACAAAGGGG - Intergenic
1054974909 9:71131484-71131506 GCAGACTGTCTGGAACATAATGG + Intronic
1060063350 9:120481320-120481342 CATCACTGTCAGCCACATAAAGG + Intronic
1060868190 9:127016445-127016467 GCTGACTTTAAGTCACAGAGGGG + Intronic
1061608386 9:131729249-131729271 GCTGACTGTCAGTTCCCCAAGGG + Intronic
1188770563 X:34148227-34148249 GCTGAGTGACAGTGACTTAATGG + Intergenic
1188796374 X:34471383-34471405 CCTGAGTGACAGTGACATAATGG + Intergenic
1197193053 X:123670283-123670305 GCTTCCTGACAGTCCCATAAGGG + Intronic
1198680890 X:139181116-139181138 CCAGACTGTGAGTCACATGAGGG - Intronic
1199045696 X:143168626-143168648 GATGACTATCAAACACATAAAGG + Intergenic
1199679079 X:150213170-150213192 CCTGGCTGTCAGTCCCATGATGG + Intergenic